situations work in pairs one is student a and the other is student b

Báo cáo y học: "Childhood adversity, mental ill-health and aggressive behavior in an African orphanage: Changes in response to trauma-focused therapy and the implementation of a new instructional system" ppt

Ngày tải lên : 13/08/2014, 18:22

... (range - 16) at t1 and M = 9.16 years (range - 16) at t2 The Tanzanian and German board of the organization managing the orphanage gave their consent and ethical approval Materials The interview ... tested before in other Sub-Saharan African settings The translators were extensively trained and the translation was discussed in detail Nevertheless, cultural bias might have influenced the findings, ... interview In addition, the behavior of all children was observed in their typical daily surrounding During the periods of assessment, interviewers and translators stayed in the orphanage and shared the...

9
405
0

The revolution in philosophy (III) - aesthetic taste, teleology, and the world order

Ngày tải lên : 01/11/2013, 08:20

... much, the intention of the artist to produce a work of such and such a style and genre – in short, displaying the conceptual background of the work of art Natural beauty, on the other hand, displays ... necessitates the claim that judgments of taste really are to be analyzed in the way Kant claims? That itself raised three other related and equally crucial issues What exactly is the capacity for taste ... pleased the observer That, too, would miss the point, Kant argued, since prima facie there is a difference between saying that something is pleasant or agreeable (angenehm) and saying that it is...

14
499
0

Báo cáo Y học: Structural study on lipid A and the O-speciﬁc polysaccharide of the lipopolysaccharide from a clinical isolate of Bacteroides vulgatus from a patient with Crohn’s disease ppt

Ngày tải lên : 31/03/2014, 23:20

... four fatty acids but no phosphate The latter component may be a byproduct of the hydrolysis reaction or a natural contaminant These results indicate that the LPS from B vulgatus mainly contains ... constituents (Table 1) The approximate molar ratio of Rha to Man was : Absolute configuration analysis demonstrated that Man has a D configuration and Rha an L configuration On methylation analysis, 2,3,4-tri-O-methyl-6-deoxyhexose, ... been isolated and characterized as having a penta-acyl and monophosphoryl structure [21] The lipid A from a closely related bacterium, Porphyromonas gingivalis, has been reported to mainly contain...

7
437
0

báo cáo khoa học: "EGFR and COX-2 protein expression in non-small cell lung cancer and the correlation with clinical features" pptx

Ngày tải lên : 10/08/2014, 10:21

... of adjuvant platinum based two drug chemotherapy Among them, 28 patients received post-operative combined chemotherapy and thoracic radiotherapy and 22 patients had chemotherapy alone Immunohistochemistry ... tumor differentiation, tumor size, TNM staging and chemotherapy/radiotherapy Based on the COX proportional hazard analysis adjusting for other significant variables, the mortality of patients with ... to be published All authors read and approved the final manuscript Competing interests We declare that we have no financial and personal relationships with other people or organizations that can...

8
434
0

báo cáo khoa học: " Correction: EGFR and COX-2 protein expression in non-small cell lung cancer and the correlation with clinical features" pps

Ngày tải lên : 10/08/2014, 10:21

... et al Journal of Experimental & Clinical Cancer Research 2011, 30:32 http://www.jeccr.com/content/30/1/32 Table (corrected table 3) EGFR expression and clinical characteristics Page of Table ... < 0.05 Author details Radiation Oncology, Tumor Center, West China Hospital, Sichuan University, PR China 2Department of Pathology, West China Hospital, Sichuan University, PR China Table (corrected ... table five) COX-2 expression in tumor and paracancerous tissue Received: 28 March 2011 Accepted: 28 March 2011 Published: 28 March 2011 Tissue type Number of cases COX-2 Positive rate(%) P value...

2
287
0

Báo cáo y học: "Surviving meningococcal septic shock in childhood: long-term overall outcome and the effect on health-related quality of life" ppt

Ngày tải lên : 13/08/2014, 21:20

... CMPB initiated this study and created the database, performed the statistical analysis and wrote the manuscript LCACV assisted in creating the database, the interpretation of the results and ... performed the statistical analysis and assisted in the interpretation of the results and writing of the manuscript EMWJ assisted in the interpretation of the results and writing of the manuscript ... (VAS) and the Disseminated Intravascular Coagulation score (DIC) [12-14] Long-term outcome variables Physical health status Parents and patients were interviewed by one paediatrician (CB) in a...

8
237
0

epidemiological characteristics of asthma in 13-14-year-old children and the effects of health education intervention in two districts of hanoi

Ngày tải lên : 04/12/2014, 03:48

... The dissertation had defended at the meeting hall of the National Institute of Hygiene and Epidemiology In ………………… The dissertation is available at: The National Library The National Institute ... to asthma are rising in many areas in the world Although there are no cure for asthma but we can control disease and maintain control it for a long period of time by conducting health education ... are farming work, painting, cleaning solution and plastic manufacturing - Host factors: the factors such as sex, weight, atopy have been considered as asthma risk factors Male sex is a risk factor...

26
231
0

Locked in tim false starts, negative feedbacks and the path to disarray of the thai party system

Ngày tải lên : 12/10/2015, 17:33

... comparison with other Asian countries (Hicken and Kuhonta 2011) Figure 1: Electoral volatility in Asia6 Malaysia II Singapore Taiwan Japan Sri Lanka Philippines I India Cambodia Indonesia South ... let alone serve as a solution to the political crisis that had dogged the country since 2006.1 The Phuea Thai Party is indirectly led by Thaksin Shinawatra, once Thailand's richest businessman and ... events and their temporally lagging impacts on the system Another point is the unit of analysis in a system This thesis attempts to explain the lack of institutionalization of the Thai party system;...

132
180
0

One substrate, two lexifiers and the lexifier effect

Ngày tải lên : 27/11/2015, 12:12

... that this paper will attempt to solve using this information 1.3 Baba Malay ada and Singapore Colloquial English got This thesis is a comparative study of two verbs, ada and got in Baba Malay and ... presented in Chapter 3, Malay ada and Baba Malay ada data is presented in Chapter 4; British English got and Singapore Colloquial got data is presented in Chapter Chapter compares and explains the findings ... aspects 34 CHAPTER MALAY ADA AND BABA MALAY ADA 4.1 Malay ada The following sub-sections describe the features of ada in Malay, which is the lexifier of Baba Malay This description of Malay...

90
282
0

English Collocations in Use Intermediate_What is a collocation

Ngày tải lên : 01/11/2013, 11:20

... pain to be racked w i t h pain to cause pain to complain of pain to ease pain to experience pain to feel pain to inflict pain to lessen pain to relieve pain to soothe pain pain subsides making ... relieve the pain cause / i n f l i c t pain He deliberately inflicted pain on his pupils complain of pain She came in complaining of stomach pains p a i n subsides As the pain subsided, I began to ... parenthood, o The parents are still in great pain over the death of their child • a pain (in the neck) INFORMAL someone or something that is very annoying: That child is a real pain in the neck C...

10
965
2

It’s Not You, It’s Your Strategy: The HIAPy Guide to Finding Work in a Tough Job Market

Ngày tải lên : 09/02/2014, 20:53

... incompatible But the failure was inevitably blamed on them: “inevitably” because abusive workplaces almost always blame the victim If such a bad episode is haunting your work history and eroding ... solution That isn’t an absolute rule, because part of what you to solve a problem is characterize and analyze it But if all you are doing is thinking about the problem and how miserable it’s making ... procrastination is not a character flaw or moral shortcoming, but merely a bad habit and understandable response to fear A little procrastination can be okay, if it helps you get through a bad day...

48
560
0

Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

Ngày tải lên : 16/02/2014, 09:20

... AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG ... SJS170 ALS030 SJS209 SJS275 SJS276 CGGAAGATCTAACTAAGCGTGCTGCTTC TACGAGATCTGTTGTTTGGAAGCAGGTT CGGAAGATCTGGGATCATGCCCATTTAG TACGAGATCTTAGCTACATTAAATAGGC GGGATCATGCCCAAGCTTATTTTCCTTACT AGTAAGGAAAATAAGCTTGGGCATGATCCC ... AACTCACCATAGGAATGCATAAGCTTTAACAAAG CCTCTTACACTTGCTTTTGAC GCAAAGGTGCCTTTGAGGTTG GACCCCTTCATTGACCTCAACTA CTTGATTTTGGAGGGATCTC TTAGCTACATTAAATAGGCAG GtaatacgactcactataGGGATCATGCCCATTTAG Forward (nt 1281–1298...

14
635
0

Tài liệu Báo cáo khoa học: Yeast glycogenin (Glg2p) produced in Escherichia coli is simultaneously glucosylated at two vicinal tyrosine residues but results in a reduced bacterial glycogen accumulation docx

Ngày tải lên : 19/02/2014, 16:20

... Santa Barbara, USA) and Optilab DSP Interferometric Refractometer (WTC), respectively The molecular mass distribution was calculated from light scattering and RI data by using the ASTRA software ... generated by either in- gel trypsination or by cyanogen bromide cleavage and subsequent a- amylase treatment were separated by RP-HPLC (SMART system, Pharmacia, Uppsala, Sweden) on a Pharmacia C2/C18 ... dominant protein band from the patterns obtained at the beginning (Glg2p0) and from the end of the incubation period (Glg2p20) were excised and digested with trypsin in the gel The resulting...

12
513
0

PEOPLE AND WORK IN EVENTS AND CONVENTIONS: A Research Perspective

Ngày tải lên : 11/03/2014, 18:05

... of the Meetings and Events Association of Australia (MEA) and serves as a state and national judge of its industry awards She is the lead author of the Australian text The Business and Management ... KwaZulu-Natal University, South Africa She has published in the area of tourism planning and management, appearing in Anatolia and Journal of Human Resources in Hospitality and Tourism She is also ... teaching approaches on the BA (Hons) Arts and Event Management (BAAEM) programme at the Arts Institute in Bournemouth (AIB) in the UK The chapter is aimed at both students preparing for a career in the...

247
441
0

Báo cáo Y học: Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku-80 subunit is necessary for basal transcription of the WD gene ppt

Ngày tải lên : 17/03/2014, 23:20

... (Fig 3A) We also observed another band of 82 kDa when the MREa-protein band from the EMSA was excised from the native gel and resolved by SDS/PAGE (unpublished data) We purified the MREa-binding ... Materials and methods and subjected to autoradiography A 70-kDa polypeptide is indicated by solid arrowhead (B) SDS/PAGE analysis of MREa-binding proteins purified by the biotinavidin method (see Materials ... sequenced amino acids Fig Confirmation that MREa-binding proteins are related to the Ku proteins (A) Immunoblot analysis of proteins eluted from the avidin– agarose beads as described in Fig 3B Both the...

11
628
0

The HIAPy Guide to Finding Work in a Tough Job Market by Hillary Rettig

Ngày tải lên : 19/03/2014, 12:32

... incompatible But the failure was inevitably blamed on them: “inevitably” because abusive workplaces almost always blame the victim If such a bad episode is haunting your work history and eroding ... solution That isn’t an absolute rule, because part of what you to solve a problem is characterize and analyze it But if all you are doing is thinking about the problem and how miserable it’s making ... procrastination is not a character flaw or moral shortcoming, but merely a bad habit and understandable response to fear A little procrastination can be okay, if it helps you get through a bad day...

48
614
0

Defining Incident Management Processes for CSIRTs: A Work in Progress pdf

Ngày tải lên : 23/03/2014, 23:21

... materials, can then be used by an organization to plan a new capability, benchmark their current capability, and provide a path for improving and expanding the capability Because of the variety of ways ... materials, organizations will be able to use the model as a framework for structuring initial incident management capabilities and sustaining and improving existing ones Additional materials based ... examples of what other teams are doing, and as a reference to existing articles, publications, books, laws, and training related to CSIRTs and incident management Use the Defining Incident Management...

249
475
0

Báo cáo khoa học: Induction of PAI-1 expression by tumor necrosis factor a in endothelial cells is mediated by its responsive element located in the 4G/5G site ppt

Ngày tải lên : 30/03/2014, 11:20

... )680) can 5824 bind transcriptional factor subunits p50 and p65 This binding is speciﬁc and can be abolished by triple mutation of the oligonucleotide, as seen both in the direct binding and during ... [21–23] Because ligand-stimulated NF-jB activation can be blocked by antioxidants, it appears that the generation of ROS may be involved in the induction of PAI-1 expression by TNFa via the activation ... )680 of PAI-1 promoter containing the jB-binding site but not by mutated fragment )664 to )680 of PAI-1 promoter NAC abolished NF-jB activation, indicating that TNFa- and H2O2-induced activation...

11
393
0

Báo cáo khoa học: "Optimization in Coreference Resolution Is Not Needed: A Nearly-Optimal Algorithm with Intensional Constraints" ppt

Ngày tải lên : 31/03/2014, 20:20

... succeeding markable? This is linguistically implausible Pronouns are acting as a kind of local variables A ’he’ at the beginning of a text and a second distant ’he’ at the end of the text hardly ... the Balas order to the more natural linear order Note that all constraints are applied in the linear variant as well, so the only difference is the ordering Linear ordering over pairs is established ... it is related to another markable that is already member of the set) it is veriﬁed that it is compatible with all members of the set A markable i is compatible with a coreference set if, for all...

9
436
0

tiếng anh chuyên ngành cầu đường: In Construction, What is a Foundation?

Ngày tải lên : 07/06/2014, 11:44

... warmer climates are not entirely exempt from such worries, however: certain soils will expand and contract when moisture is added or taken away, and engineers must factor in such movement ... is added or taken away, and engineers must factor in such movement when considering where and how to lay a foundation ...

2
724
4