single nucleotide polymorphisms and simple sequence repeats
báo cáo khoa học: " Identification of Single Nucleotide Polymorphisms and analysis of Linkage Disequilibrium in sunflower elite inbred lines using the candidate gene approach" docx
... wild and cultivated sunflower Results SNPs frequency and nucleotide diversity A total of 64 candidate regions related to biotic and abiotic stresses were selected for SNP identification and nucleotide ... Abbreviations SNP single nucleotide polymorphism, indels short insertions and/ or deletions, SSRs simple sequence repeats, bp base pairs, kbp kilo base pairs, LD linkage disequilibrium, EST expressed sequence ... not be sequenced directly were cloned into pGEMT-easy (Promega, Madison, USA) and at least two clones were sequenced with forward and reverse primers to discard PCR errors The nucleotide sequences...
- 14
- 324
- 0
Báo cáo sinh học: " Toll-like receptor 4 single-nucleotide polymorphisms Asp299Gly and Thr399Ile in head and neck squamous cell carcinomas" potx
... and GL provided study materials or patients HSB, PS, JG, AB, CW and GL participated in collection and assembly of data CP and AS participated in data analysis and interpretation CB, HSB, AB and ... doi:10.1186/1479-5876-9-139 Cite this article as: Bergmann et al.: Toll-like receptor singlenucleotide polymorphisms Asp299Gly and Thr399Ile in head and neck squamous cell carcinomas Journal of Translational Medicine ... Informatics, Biometry and Epidemiology, University of Duisburg Essen, Hufelandstrasse 55, 45122 Essen, Germany Authors’ contributions CB designed the study and participated in data analysis and interpretation...
- 9
- 335
- 0
báo cáo hóa học:" Toll-like receptor 4 single-nucleotide polymorphisms Asp299Gly and Thr399Ile in head and neck squamous cell carcinomas" doc
... and GL provided study materials or patients HSB, PS, JG, AB, CW and GL participated in collection and assembly of data CP and AS participated in data analysis and interpretation CB, HSB, AB and ... doi:10.1186/1479-5876-9-139 Cite this article as: Bergmann et al.: Toll-like receptor singlenucleotide polymorphisms Asp299Gly and Thr399Ile in head and neck squamous cell carcinomas Journal of Translational Medicine ... Informatics, Biometry and Epidemiology, University of Duisburg Essen, Hufelandstrasse 55, 45122 Essen, Germany Authors’ contributions CB designed the study and participated in data analysis and interpretation...
- 9
- 417
- 0
Báo cáo y học: "Association of single-nucleotide polymorphisms in RHOB and TXNDC3 with knee osteoarthritis susceptibility: two case-control studies in East Asian populations and a meta-analysis" docx
... samples and participated in the design and analysis of the study, and MN genotyped the Japanese samples JD, JQ, NJ, YX, CY and JW evaluated the patients and genotyped Chinese samples, and TN helped ... Nanjing University, and single nucleotide Page of (page number not for citation purposes) polymorphism (SNP) Research Center of RIKEN, and informed consent was obtained from patients and control individuals ... association between the RHOB and TXNDC3 SNPs and knee OA susceptibility, we conducted two case-control studies in Han Chinese and Japanese populations and a meta-analysis Materials and methods A population...
- 6
- 438
- 0
báo cáo khoa học: " Ethical issues raised by common copy number variants and single nucleotide polymorphisms of certain and uncertain significance in general medical practice" potx
... Incest and mental handicap J Ment Defic Res 1990, 34:483-490 doi:10.1186/gm163 Cite this article as: Beaudet AL: Ethical issues raised by common copy number variants and single nucleotide polymorphisms ... cost effective, is not evidence based and may lead to stigmatization or undue anxiety [15,16] Assuming lowcost and high-throughput genotyping and good physician and patient education, this form of ... disomy causing disorders such as Prader-Willi and Angelman syndromes and in identifying candidate gene regions for disease in children born of first cousin and similar matings However, the occurrence...
- 6
- 307
- 0
Báo cáo y học: "TLR7 single-nucleotide polymorphisms in the 3’ untranslated region and intron 2 independently contribute to systemic lupus erythematosus in Japanese women: a case-control association study" ppsx
... analysis and statistical analyses; and wrote the manuscript HF, YK, SI, TH, MK, IM, ST, YT, HH and TS recruited the patients and controls and collected clinical information NT designed and coordinated ... panel consisting mainly of Chinese and Korean populations, the association of 27 singlenucleotide polymorphisms (SNPs) in the TLR7-TLR8 region with SLE was examined, and a significant association ... intron 2, rs179019 and rs179010, was newly detected (Figure and Table 1) Significant association of rs179019 and rs179010 was observed under the recessive model for the A and T alleles, respectively...
- 8
- 341
- 0
Báo cáo y học: "Association of IL-4RA single nucleotide polymorphisms, HLA-DR and HLA-DQ in children with Alternaria-sensitive moderate-severe asthm" pptx
... direction Both forward and reverse sequencing primers were used to maintain quality control Primer sequences and conditions are available upon request The presence of IL-4RA nucleotide polymorphisms was ... Aspergillus Der p and/ or Der f 43 52 28 37 Cat 46 28 CR 28 22 Trees 78 57 Grasses 56 54 Weeds 68 48 The results of IL-4RA single nucleotide polymorphisms (SNP) are seen in Table The presence and allele ... chain; SNP single nucleotide polymorphisms Data presented as percentage (%) of patients and in parentheses, allele frequency P value using Fisher’s exact test Knutsen et al Clinical and Molecular...
- 9
- 318
- 0
KHAI THÁC D. LI.U ESTs (EXPRESSED SEQUENCE TAGs) . CHI CAM CHANH (CITRUS) CHO VI.C PHÁT TRI.N MARKER PHÂN T. SSR (SIMPLE SEQUENCE REPEATS)
... Extraction and Report Language PHP Hypertext Preprocessior RDBMS Relational Database Management System SNP Single Nucleotide Polymorphism SSCP Single- Strand Conformation Polymorphism SSR Simple Sequence ... database and integrated SSR finder tool into the BUILDING SSRs DATABASE of Citrus Website After cleaning, masking repeat, vector and organelle sequences, the EST-SSR sequences and the related EST sequences ... có : Dinucleotide SSR (GT)6 GTGTGTGTGTGT Trinucleotide SSR (CTG)4 CTGCTGCTGCTG Tetranucleotide SSR (ACTC)4 ACTCACTCACTCACTC Trinucleotide SSR xuất dinucleotide SSR khoảng 10 lần, tetranucleotide...
- 71
- 249
- 0
Nghiên cứu chỉ thị phân tử SSR (simple sequence repeats) trong chọn giống lúa
... ngẫu nhiên (Randomly Amplified Polymorphic DNA) RFLP: Đa hình độ d i đoạn cắt giới hạn (Restriction Fragment Lengh Polymorphisms) SSR: Đa hình đoạn lặp lại đơn giản (Simple Sequence Repeats) TAE: ... Fragment Length Polymorphisms (AFLP) - Chỉ thị dựa sở chuỗi có trình tự lặp lại (Repeatitive sequences): + Tiểu vệ tinh (Minisatellite) + Đa hình đoạn lặp lại đơn giản - Simple Sequence Repeats (SSR) ... giống Xuất phát từ mục tiêu trên, tiến h nh đề t i: "Nghiên cứu sử dụng thị phân tử SSR (Simple Sequence Repeats) chọn giống lúa 1.2 Mục đích yêu cầu đề tài 1.2.1 Mục đích Xác định đợc mối quan...
- 120
- 1,536
- 4
Nghiên cứu chỉ thị phân tử SSR (simple sequence repeats) trong chọn giống lúa
... ngẫu nhiên (Randomly Amplified Polymorphic DNA) RFLP: Đa hình độ d i đoạn cắt giới hạn (Restriction Fragment Lengh Polymorphisms) SSR: Đa hình đoạn lặp lại đơn giản (Simple Sequence Repeats) TAE: ... Fragment Length Polymorphisms (AFLP) - Chỉ thị dựa sở chuỗi có trình tự lặp lại (Repeatitive sequences): + Tiểu vệ tinh (Minisatellite) + Đa hình đoạn lặp lại đơn giản - Simple Sequence Repeats (SSR) ... giống Xuất phát từ mục tiêu trên, tiến h nh đề t i: "Nghiên cứu sử dụng thị phân tử SSR (Simple Sequence Repeats) chọn giống lúa 1.2 Mục đích yêu cầu đề tài 1.2.1 Mục đích Xác định đợc mối quan...
- 120
- 1,252
- 3
BÁO CÁO " MỐI TƯƠNG QUAN GIỮA SNP (Single nucleotide polymorphisms) CỦA GEN CHH (crustacean hyperglycemic hormone) VÀ TÍNH TRẠNG TĂNG TRƯỞNG CỦA TÔM CÀNG XANH " potx
... Zoology 284, 217-224 Tao, W.J., Boulding, E.G., 2003 Associations between single nucleotide polymorphisms in candidate genes and growth rate in Arctic charr (Salvelinus alpinus L.) Heredity 91, 60-69 ... freshwater giant prawn, Macrobrachium rosenbergii Comparative Biochemistry and Physiology, Part A 121, 315-321 Liu, Z., 2007 Single nucleotide polymorphism (SNP) In: Liu, Z (Ed.), Aquaculture Genome ... Physiological Zoology 70, 415-420 Schaid, D.J., Rowland, C.M., Tines, D.E Jacobson, R.M., Poland, G.A., 2002 Score tests for association between traits and haplotypes when linkage phase is ambiguous...
- 10
- 477
- 1
single nucleotide polymorphisms - pui-yan kwok
... products are denatured to become single- stranded, and separated by gel electrophoresis under nondenaturing conditions A single- stranded fragment with a mutation or single nucleotide polymorphism (SNP) ... labeled with a fluorophore 2.2 Sequences and Samples For the examples shown in Fig and Fig 2, the following sequences, with priming regions typed in lower case and positions and chemical nature of polymorphic ... human diversity panel cSequence 1, see Sequences and samples NED-labeled fragment and at position 325 (T/G) and 346 (T/C) for the ROX-labeled fragment from exon 26 Oligonucleotides labeled with...
- 284
- 229
- 0
Báo cáo khoa học: "Identification of single-nucleotide polymorphisms of the prion protein gene in sika deer (Cervus nippon laiouanus)" potx
... eht ni 631 nodoc ta msihpromylop editoelcun-elgniS PNRP reed akis eht fo pb 177 ;1 enal ,reddal AND pb 001 ;M )PNRP( eneg noirp reed akis eht fo noitacifilpmA giF giF la te gnoeJ gnoeJ-nuyH 003...
- 3
- 298
- 0
Báo cáo khoa học: "Origin identification of maritime pine stands in France using chloroplast simple-sequence repeats" potx
... about 30,000 of P pinaster stands, and financial losses were considerable [6] To overcome this problem and to avoid further damage, from 1986 onwards candidate stands for seed collection in the ... environmental conditions, and they may also influence adjacent native stands by pollen and seed dissemination The establishment of forest plantations throughout the world demands increasing amounts ... were used 2.2 CpSSR and terpene analysis Total DNA was extracted according to the Doyle and Doyle [10] protocol with modifications described by Lerceteau and Szmidt [18] and Plomion et al [25]...
- 10
- 334
- 0
Báo cáo y học: "NGR1 single nucleotide polymorphisms in rheumatoid arthritis" pdf
... performed by allele-specific PCR and verified by direct sequencing PCR primer and probe sequences for the V14M SNP were 5' -AGTGGAGTGGCTACAAAGGTCCC-3' (forward primer) and 5' CCCATCTCAGCCCTGCTCAC/T-3' ... (reverse primer) PCR primer and probe sequences for the L467P SNP were 5' CATGTGCTAGTGGATCTACT/C-3' (forward primer) and 5' AGTGGAGTGGCTACAAAGGTCCC-3' (reverse primer) Results and discussion In marked ... years (17–81 years), and 76% were female A cohort of 171 healthy individuals matched on the basis of age, sex and origin were used as a healthy control group All protocols and recruitment sites...
- 3
- 257
- 0
báo cáo khoa học: " Single nucleotide polymorphisms for assessing genetic diversity in castor bean (Ricinus communis)" potx
... JTF, GJA, PDR, and PK analyzed the data and wrote the manuscript PK and PDR designed the study APC, PDR, and JR sequenced the cultivars, generated the methylation-filtration libraries and performed ... pets, and livestock and are the source of the poison ricin [14] Castor bean plants commonly escape cultivation and are found in disturbed sites such as roadsides, stream banks, abandoned lots, and ... rates using single nucleotide polymorphisms Genetics 2000, 154:931-942 37 Wakeley J, Nielsen R, Liu-Cordero SN, Ardlie K: The discovery of singlenucleotide polymorphisms and inferences about human...
- 11
- 470
- 0
Báo cáo y học: "Using single nucleotide polymorphisms as a means to understanding the pathophysiology of asthma" pps
... Fallin D, Lanchbury JS: Single nucleotide polymorphisms and the future of genetic epidemiology Clin Genet 2000, 58:250–264 33 Gray IC, Campbell DA, Spurr NK: Single nucleotide polymorphisms as tools ... Lipshutz R, Chee M, Lander ES: Large-scale identification, mapping, and genotyping of single- nucleotide polymorphisms in the human genome Science 1998, 280:1077–1082 30 Kruglyak L, Lander E: High-resolution ... constructed This review summarizes current and potential future contributions of one type of DNA sequence variant, single nucleotide polymorphisms (SNPs), to our understanding of asthma pathophysiology...
- 11
- 491
- 0
BÀI BÁO CÁO TÌM HIỂU VỀ SNP (SINGLE NUCLEOTIDE POLYMORPHISMS)
... Thơ, tháng 10 năm 2012 SNP (SINGLE NUCLEOTIDE POLYMORPHISMS) I GIỚI THIỆU VỀ SNP - SNPs (đọc snip) viết tắt từ chữ Single Nucleotide Polymorphisms, có nghĩa dạng đa hình nucleotide đơn Marker thường ... for Gold in Genome Gulch 2002 The Scientist 13 Single Nucleotide Polymorphisms: From the Evolutionary Past 2001 Nature 14 Single Nucleotide Polymorphisms: To a Future of Genetic Medicine ... biến điểm nucleotide genome (hình 1) Hình 1: Một đột biến điểm xảy dẫn đến thay cặp nucleotide G – C A – T ngược lại tạo SNP - Đa hình đơn nucleotide, SNPs biến thể trình tự DNA xảy đơn nucleotide...
- 14
- 1,191
- 4
Genetic variability in tomato germplasm (solanum lycopersicum l ) using morphological characteristics and simple sequence repeat (SSR) markers
... are unavailable (Bindler et al., 2007) 2.9 Simple Sequence Repeats (SSR) markers Simple sequence repeats (SSR) are regions of DNA that consist of short, tandem repeated units (2-6 bp in length) ... Polymorphism (RFLP), Random Amplified Polymorphic DNA (RAPD) and microsatellites or Simple Sequence Repeats (SSR), have been widely used to estimate genetic variability and phylogenetic studies ... (RFLP), Random Amplified Polymorphic DNA (RAPD) and Simple Sequence Repeats (SSR) (Bredemeijer et al.,1998; Villand et al., 1998; Park et al., 2004 and Garcia-Martinez et al., 2006) Comparatively,...
- 113
- 380
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008