senescence aging and tumor suppression

Tài liệu Population Aging and Economic Growth in China doc

Ngày tải lên : 13/02/2014, 18:20

... David Canning, and Günther Fink, "Population Aging and Economic Growth", forthcoming in Spence, Michael, and Danny Leipziger (eds.), Global Challenges and Growth, Commission on Growth and Development ... savings in anticipation of retirement, and the flexibility of capitalist economies to adapt to changes in labor supply and demand and to alter management and labor practices in light of changing ... well-off consumers and that benefits from extraordinary demand for its exports, the forces of supply and demand will tend to raise wages in sectors where labor is in greater demand Such increases...

42
749
0

Neuropilin: From Nervous System to Vascular and Tumor Biology potx

Ngày tải lên : 14/03/2014, 21:20

... various tumors Overexpression of NRP1 in rat tumor cells results in enlarged tumors and substantially enhanced tumor angiogenesis On the other hand, soluble NRP1 (sNRP1) is an antagonist of tumor ... capillaries and hemorrhaging NRP1 knockouts have defects in yolk sac, embryo and neuronal vascularization, and in development of large vessels in the heart Tumor cells express NRPs and bind VEGF165 ... vasculature, and limb;11 many adult tissues such as the heart, placenta, lung, kidney and epidermis,12-14 and uterine glandular epithelium;15 and many cell types such as endothelial cells (EC),11 tumor...

156
4K
1

Báo cáo khoa học: Do bacterial genotoxins contribute to chronic inﬂammation, genomic instability and tumor progression? pot

Ngày tải lên : 14/03/2014, 22:20

... genotoxins and genomic instability L Guerra et al (DNA resection); and (c) phosphorylation ⁄ activation of CHK2 and p53 that lead to cell cycle arrest and, in ultimate instances, to apoptosis or senescence ... ssDNA ends and modulates the activity of effectors, such as BRCA2 and Rad51, which execute the recombination process by performing strand invasion and Holliday junction formation and resolution ... pro-inﬂammatory (TNF-a, IFN-c and Cox-2, IL-6 and TGF-a) and anti-apoptotic (Bcl-2 and Bcl-XL) genes, as well as upregulation of hepatic mRNA levels of components of the NF-jB pathway (p65 and p50) [70] The...

12
334
0

Aging and decision making: a comparison between neurologically healthy elderly and young individuals ppt

Ngày tải lên : 22/03/2014, 14:20

... overconfidence and points above would show underconfidence Fig contains these scatters for both older and younger subjects, along with standard errors and significance tests for differences in accuracy and ... offer was randomly determined and not based on the actual value of the item (Becker et al., 1964) For sellers, if WTA was less than or equal to the random offer, they gave up their item and received ... Fellowship, and the David and Lucile Packard Foundation are gratefully acknowledged.For their reading of and helpful responses to early versions of our paper, we thank an Associate Editor and an anonymous...

16
597
0

The State of Aging and Health in America pot

Ngày tải lên : 28/03/2014, 20:20

... healthy aging and serve as a catalyst for improvement and advancement We hope that health care professionals, policy makers and everyone interested in the challenges and consequences of our aging ... National Report Card on Healthy Aging 04 The State-by-State Report Card on Healthy Aging 09 Mental Health and Aging 12 Training the Health Care Workforce—Present and Future 15 Appendix 19 III The ... Database and arthritis) and diseases (including cardiovascular diseases, diabetes, and certain cancers) in later life Older Americans consume too much saturated fat and too few fruits and vegetables...

28
388
0

Báo cáo khoa học: Nuclear factor kappa B and tumor necrosis factor-alpha modulation of transcription of the mouse testis- and pre-implantation development-speciﬁc Rnf33⁄Trim60 gene pot

Ngày tải lên : 29/03/2014, 00:20

... Rnf33 mRNA in the testis and in two mouse testicular cell lines: TM3 and TM4 (Fig 2) TM3 and TM4 are nontumorigenic epithelial cell lines derived from mouse testicular Leydig and Sertoli cells, respectively ... the p65 and p50 NF-jB subunit proteins in testicular cells (A) RT-PCR detection of p50 and p65 transcripts in the testis (Te) and in TM3 and TM4 cells (B) Western blot analysis of the p50 and p65 ... TM3 and TM4 cells, a protein-induced band shift was observed (Fig 6A, lanes and 7, arrowhead) In the presence of increasing amounts of the unlabeled wild-type probe sequence, the shifted band...

14
381
0

Báo cáo khoa học: Constitutive expression of the human peroxiredoxin V gene contributes to protection of the genome from oxidative DNA lesions and to suppression of transcription of noncoding DNA pdf

Ngày tải lên : 30/03/2014, 11:20

... serum and phenol red were washed with NaCl ⁄ Pi, and the DMEM without fetal calf serum and phenol red was added (2 mL per 60-mm dish) followed by the addition of CSE (2% ﬁnal concentration) and ... using two different dilutions (1 : and : 729) of template cDNA from the control clone (lanes and 3) and the same dilutions of cDNA from the KD-1 clone (lanes and 4) Control reactions with b-actin ... targeting PRDX5 cDNA (exons and underlined) were: TTTGAGA ACCTCTTGAGACGTCGATGACGTCTCAAGAGGTTC TCTTTTT (top strand) and CTAGAAAAAGAGAA CCTCTTGAGACGTCATCGACGTCTCAAGAGGTTCT (bottom strand) Targeted segments...

11
463
0

a means to an end the biological basis of aging and death apr 1999

Ngày tải lên : 11/06/2014, 05:26

... Introduction, ix xiii Aging, Senescence, and Lifespan, T h e Nature of Cellular Senescence and Death, T h e Evolution of Senescence and Death, 21 41 Of Embryos and Worms and Very Old Men: T h ... Genetics of Senescence and Lifespan, 59 Human Genetic Diseases T h a t M i m i c the Aging Process, 73 Cycling to Senescence, Replicative Immortality: Cancer and Aging, 115 Caloric Restriction and Maximum ... death and programmed death (senescence) Maximum lifespan, on the other hand— and this is a very important distinction—is determined solely by the rate and timing of the onset of senescence, and...

246
670
0

báo cáo hóa học:" Semi-allogeneic vaccines and tumor-induced immune tolerance" pdf

Ngày tải lên : 18/06/2014, 15:20

... developed tumors, and from vaccinated mice that did not develop tumors These two RNA pools were analyzed for T-cell and B-cell activation (SA Biosciences, cat # PAMM-053), and for T-cell anergy and ... tumors can indirectly suppress anti -tumor immunity; therefore, immunotherapy modalities aimed at concurrently stimulating anti -tumor immune reactivity, while diminishing tumorinduced immune suppression ... reasonable understanding of anti -tumor effector mechanisms, clinical studies investigating spontaneous anti -tumor immune responses have yet to lead to reproducible or consistent tumor regression...

6
426
0

báo cáo hóa học:" Regression of orthotopic neuroblastoma in mice by targeting the endothelial and tumor cell compartments" pdf

Ngày tải lên : 18/06/2014, 15:20

... host animal induced tumor regression and reduced bone marrow and liver metastases by a dual mechanism of action, restraining growth of both tumor cells and tumor vasculature Methods CHS 828 The ... the inhibition of angiogenesis, and direct tumor cell toxicity The two processes (angiogenesis inhibition and tumor cell toxicity) may have different kinetics and may vary in proportion with ... Statistical analysis (Mann-Whitney U test) indicates group differences in tumor volume, tumor weight and tumor index (tumor weight/final body weight × 100) Click here for file [http://www.biomedcentral.com/content/supplementary/14795876-7-16-S1.doc]...

11
593
0

Báo cáo hóa học: " Comparison of T-cell receptor repertoire restriction in blood and tumor tissue of colorectal cancer patients" docx

Ngày tải lên : 18/06/2014, 16:20

... undergoing tumor resection RNA was extracted from the macroscopic center of the tumor and from unaffected colonic mucosa at least cm from the macroscopic border of the malignant lesion Age, sex, and ... unaffected colon and carcinoma tissue (paired, pCD = 0.471, pn(F) = 0.2783, Figure 4C) Comparison of elevated families in different compartments For 16 patients, samples of tumor and tumor free colon ... of these patients a single family was elevated in both tumor tissue and corresponding unaffected colon For nine CRC patients, blood and tumor samples were available Four of these patients had...

9
416
0

Báo cáo hóa học: " Aging and partial body weight support affects gait variability" ppt

Ngày tải lên : 19/06/2014, 08:20

... with physiologic aging resulting in increased randomness and noise in the neuromuscular system They suggested that this may be one of the reasons for the increase in falling due to aging Body weight ... evaluate the benefits of BWS and observe whether gait could be recovered The original results for these animal models were encouraging and thus, the usage of BWS has been expanded in human patient ... (magnitude; standard deviations and coefficient of variations) and nonlinear (structure; Lyapunov exponents) measures [37] It was hypothesized that increased levels of BWS would decrease both linear and...

11
230
0

báo cáo hóa học: " Aging and selective sensorimotor strategies in the regulation of upright balance" docx

Ngày tải lên : 19/06/2014, 10:20

... in the physical demands, problem solving, and random presentation of practice tasks, sufficient practice and patient empowerment [30] Even with a one-hour immersion in VE and exposure to sensory ... stance, subjects were exposed to random visual and/ or surface perturbations consisting of ramp-andhold tilts of 8° (peak velocity of 36°/s) in each direction of the pitch and roll planes Visual perturbations ... digitized, band-pass filtered (10–400 Hz lowpass) and sampled at 1,080 Hz EMG signals were further full-wave rectified and lowpass filtered at 100 Hz during offline analysis Functional balance and mobility...

7
396
0

Báo cáo hóa học: " Genetic diversity and silencing suppression effects of Rice yellow mottle virus and the P1 protein" doc

Ngày tải lên : 20/06/2014, 01:20

... isolates belonging to the same serotype Ni2 and CI4, or, CI63 and BF1 isolates (Figure 3C, lanes and or and 5) We also noted that the diversity of silencing suppression displayed by these RYMV isolates ... Movement of P1 protein and silencing suppression Movement of P1 protein and silencing suppression (A) Schematic representation of the experimental design to distinguish delivery (del) and distal (dis) ... plant at 35 or 40 dpi and separated into two independent samples before being ground for proteins (fluorimetry, ELISA and western) and RNA extractions Plasmid construction and biolistic delivery...

12
384
0

báo cáo hóa học:" Neuronal transcription factor Brn-3a(l) is over expressed in high-grade ovarian carcinomas and tumor cells from ascites of patients with advanced-stage ovarian cancer" ppt

Ngày tải lên : 20/06/2014, 07:20

... benign and borderline tumors compared to grades 1, and tumors (c2 = 14.33, df = 4, P = 0.006) To further analyze differences between each individual tissue and tumor types Kruskal Wallis and Dunn’s ... grade and grade ovarian tumors Medians are shown as horizontal lines Significant differences in the extent of epithelial and stromal Brn-3a(l) staining between normal and grades 1, and tumors ... staining Staining was confined to both nucleus and cytoplasm (Figs 2d and 2e) The staining intensity in both the epithelium and stroma of grades 1, and tumors was also enhanced None of the tissues...

12
267
0

Báo cáo hóa học: " Efﬁcient Alternatives to the Ephraim and Malah Suppression Rule for Audio Signal Enhancement" doc

Ngày tải lên : 23/06/2014, 01:20

... subtraction Wiener suppression rule Magnitude spectral subtraction Figure 8: Standard suppression rules 20 30 Alternative Suppression Rules for Audio Signal Enhancement Narrowband speech 16 12 ... 5: MAP approximation suppression rule gain difference Figure 3: Ephraim and Malah MMSE suppression rule Gain difference (dB) 1047 Gain difference (dB) Gain (dB) Alternative Suppression Rules for ... freedom and pa2 rameters (σk , s2 ) k When combined with the optimal phase estimator of Ephraim and Malah (i.e., the observed phase ϑk ), this estimator also takes the form of a suppression rule and...

9
314
0

Báo cáo khoa học: "Season of birth, clinical manifestations and Dexamethasone Suppression Test in unipolar major depression" docx

Ngày tải lên : 08/08/2014, 23:20

... scores between winter and spring (23.58 ± 6.61 vs 30.29 ± 6.60, p = 0.025) and between spring and summer (30.29 ± 6.60 vs 21.29 ± 4.68, p = 0.008) and in HAS scores between spring and summer (38.29 ... Dexamethasone Suppression Test (DST) [9] According to the DST protocol, mg of dexamethasone was given orally at 23.00 on day 1, and three samples of blood were taken at 23.00 on day and at 16.00 and 23.00 ... were reported by Hare in 1975 [21] That study was conducted in England and Wales, using patients born between 1921 and 1955, and reported that compared with all live births, manic depression was...

6
286
0

Báo cáo y học: "Interactions between IL-32 and tumor necrosis factor alpha contribute to the exacerbation of immune-inflammatory diseases" ppt

Ngày tải lên : 09/08/2014, 08:23

... IL32γ, and IL-32δ IL-32α is present in intracellular locations, and IL-32β is secreted from the cells IL-32α and IL-32β are thought to be the major expressed variants The sequences of IL-32β and ... variant and as a secreted protein from the cells, and the sequences of IL-32β and IL-32γ were basically similar [13] We demonstrated that IL-32 is expressed in various lymphoid cells, and in the ... (BM-hIL32) The expression and secretion of TNFα were increased in resting F4/80+ splenic macrophages of BM-hIL-32 mice, and the expression and secretion of TNFα, IL-1β, and IL-6 were increased...

13
552
0

Báo cáo khoa học: "Quality of life and tumor control after short split-course chemoradiation for anal canal carcinoma" ppsx

Ngày tải lên : 09/08/2014, 08:23

... radiotherapy and concurrent chemotherapy with fluorouracil (5-FU) and Mitomycin C (MMC) Secondary endpoints were acute toxicity, local and regional tumor control, colostomy-free survival and overall ... with a T4 tumor received a boost of external beam radiation of Gy and 10 Gy directed to the primary tumor with another concurrent cycle of 5-FU and MMC for persistent disease Ninety-five and 89% ... local and the regional control according to the node-status was N0-75% and 88% and N(1-3)-85% and 93% respectively Among the eleven patients who had a local relapse, had isolated local relapse and...

8
246
0

Báo cáo khoa học: "F-FDG PET/CT-based gross tumor volume definition for radiotherapy in head and neck Cancer: a correlation study between suitable uptake value threshold and tumor parameters" pdf

Ngày tải lên : 09/08/2014, 09:20

... factors responsible for SUV measurements and therefore tumor contours: the metabolic activity, tumor heterogeneity, and tumor motion [21] Despite the effect of tumor motion can be neglected in RT ... contouring of hypermetabolic areas Delineation of CT-based tumor volume On the basis of axial CT images, contouring of the tumor volume and normal and critical structures was performed without knowledge ... between the SUVmax and the C-pGTV values in our patient cohort (Figure 4) Also, there was no correlation between the maximum tumor diameter and the SUVmax Correlation of sTL with C-pGTV and SUVmax Figure...

8
368
0