selection by phage display of single domain antibodies speci fi c to antigens in their native conformation
Báo cáo y học: "Direct selection and phage display of a Gram-positive secretom" ppsx
... Figure Phage display vector for selective secretome display Phage display vector for selective secretome display C- gIII, carboxyterminal domain of gIII; CmR, chloramphenicol resistance cassette; colE1 ... (5'-GGCCCGGAAGAGCTGCAGCATGATGAAATTC-3', containing an EarI site (underlined) at the 5' end) and pDJ01R01 (5'-GGGGAATTCTCTAGA CCCGGGGCATGCATTGTCCTCTTG-3', containing, from the 5' end, EcoRI (first ... screened by dot-blot hybridization) contained 87 distinct ORFs predicted to encode secretome proteins in- frame with pIII Of the remaining 80 non-secretome inserts, 52 contained inserts encoding very...
- 15
- 297
- 0
Tài liệu Báo cáo khoa học: Selection of stably folded proteins by phage-display with proteolysis docx
... Chymotrypsin Trypsin/Chymotrypsin/Pepsin Arg -c Trypsin/Thermolysin Trypsin surface/core core surface core surface/core surface decrease decrease increase increase increase increase no no no yes yes ... of the minor coat protein (g3p) are responsible for binding and infection in E coli Thus, incorporation of a library of target proteins between the N-terminal domain and the C- terminal (CT) domain ... any cofactors In this work, the authors used the method similar to that of Finucane et al [11] except that the protein A B -domain instead of His-tag was used to select the folded proteins Cytochrome...
- 6
- 444
- 0
Studies on the antibody repertoire in a dengue virus immune subject and isolation of neutralizing antibodies by phage display technology
... of DENV to host cell is mediated by several known surface receptors, such as DC-SIGN (Dendritic-cell-specific ICAM-grabbing non-integrin, which is a 19 mannose-specific lectin that interacts with ... DENV-specific T lymphocytes may have a role in viral clearance by the killing of virus-infected cells and secreting the pro-inflammatory cytokines to limit the infection The roles of cellular ... reaching confluence, the splitting of cell 34 monolayer was done by incubating the cells with Trypsin-EDTA (Gibco, Invitrogen) at 37 C for 2-3 minutes Cells were centrifuged to remove Trypsin-containing...
- 122
- 342
- 0
Báo cáo khoa học: Identification of calreticulin as a ligand of GABARAP by phage display screening of a peptide library pdf
... partners Calreticulin (CRT) was successfully identified as a novel GABARAP binding protein Results In vitro selection of GABARAP peptide ligands To determine the peptide binding speci city of GABARAP, ... observation of decreasing binding capacity holds true for the whole series of successive binding experiments To extract binding kinetics, all binding curves were fitted simultaneously with a global association ... GABARAP by fluorescence titration experiments Fluorescein fluorescence of fN1 was monitored in the presence of increasing amounts of GABARAP (Fig 2) The fluorescence data obtained were fitted with a single...
- 13
- 560
- 0
Báo cáo khoa học: Llama single-domain antibodies directed against nonconventional epitopes of tumor-associated carcinoembryonic antigen absent from nonspecific cross-reacting antigen doc
... VH1–Sfi: 5¢-CATGCCATGACTCGCGGCCCAGCCGGCCATGGC CCAGGTGCAGCTGGTGCAGTCTGG-3¢; 5¢ VH2–Sfi: 5¢-CATGCCATGACTCGCGGCCCAGCCGGCCATGGC CCAGGTCACCTTGAAGGAGTCTGG-3¢; 5¢ VH3–Sfi: 5¢-CATGCCATGACTCGCGGCCCAGCCGGCCATGGC ... 3883 CEA -speci c single domain antibodies G Behar et al Table Kinetic and affinity constants of the binding of soluble carcinoembryonic antigen (sCEA) to CEA -speci c sdAbs immobilized via monoclonal ... 5¢-CATGCCATGACTCGCGGCCCAGCCGGCCATGGC CGAGGTGCAGCTGGTGGAGTCTGG-3¢; 5¢ VH4–Sfi: 5¢-CATGCCATGACTCGCGGCCCAGCCGGCCATGGC CCAGGTGCAGCTGCAGGAGTCGGG-3¢) and one forward primer (CH2FORTA4) These primers allow the amplification of two...
- 13
- 529
- 0
Báo cáo Y học: Substrate specificity of human kallikrein 2 (hK2) as determined by phage display technology docx
... good enrichment in the selection of speci c enzyme substrates [13,15,25] The determination of the speci city constants of the substrates showed a positive tendency during the selection Most of the ... fluorescence reader (10) which permitted to determine the percentage of hydrolysis, the speci city constant and the site of cleavage (11) Direct determination of the kcat/Km using CFP fluorescent ... GdN– HCl in NaCl/Pi at pH 8.0 containing 10 mM 2-mercaptoethanol) to recover the soluble and insoluble fractions All recombinant CFPs were purified in denaturing conditions to prevent substrate cleavage...
- 8
- 411
- 0
Báo cáo khóa học: Development of recombinant inhibitors specific to human kallikrein 2 using phage-display selected substrates docx
... 5¢-TACCGCGGTCAAAATCACCCTCC GTTCTCGAGCAGTGGAGACGCGTGA-3¢; rACT6.3, 5¢-TACCGCGGTCAAAATCACCAGGAGGTCTATC GATGTGGAGACGCGTGA-3¢; rACT8.3, 5¢-TACCGCG GTCAAAATCAGGGGGAGATCTGAGTTAGTGGA GACGCGTGA-3¢; rACT6.7, 5¢-TACCGCGGTCAAAAT ... 5¢-TACCGCGGTCAAAAT CAAGCTTAGAACAACATTAGTGGAGACCGCTG A-3¢; rACT6.1, 5¢-TACCGCGGTCAAAATCATGACAA GATCTAACTTAGTGGAGACGCGTGA-3¢; rACT5.18, 5¢-TACCGCGGTCAAAATCACCGAGCGTGTCTCG CCCGTGGAGACGCGTGA-3¢ (where ... fully intact ACTs purified in one step by affinity chromatography The efficiency of the bacterial recombinant system to produce active ACT was proved by the stoichiometry of inhibition of recombinant...
- 7
- 374
- 0
Báo cáo y học: "Translational Medicine and Reliability of Single-Nucleotide Polymorphism Studies: Can We Believe in SNP Reports or Not"
... J, Cortés A, Barnadas A, Baiget M Pharmacogenetic prediction of clinical outcome in advanced colorectal cancer patients receiving oxaliplatin/5-fluorouracil as first-line chemotherapy Br J Cancer ... prediction of clinical outcome to 5-FU/oxaliplatin combination chemotherapy in refractory colorectal cancer Br J Cancer 2004;91:344-54 53 Sweeney C, Nazar-Stewart V, Stapleton PL, Eaton DL, Vaughan ... (“false-positive” reporting) is a particular threat to the credibility of the literature, including genetic association studies, since it may affect decision-making both in clinical and pharmacological development...
- 9
- 524
- 0
Tài liệu Báo cáo khoa học: Extended half-life upon binding of destabilized intrabodies allows specific detection of antigen in mammalian cells pdf
... oligonucleotides 5¢-CTAGTCGTCCGAACTCCGATAATCGC CGTCAGGGCGGTCGCGAACGTTTAG-3¢ and 5¢-CA TGCCAAACGTTCGCGACCGCCCTGACGGCGATTA TCGGAGTTCGGACA-3¢ into the unique SpeI restriction site p13R4-DP was obtained ... except that the following primers 5¢-ACTCATA CTAGTCTTAGCCATGGCTTCCCGCCG GCG-3¢ and 5¢-CCATCCGAATTCTCACTACACATTGATCCTAGCA GAAGC-3¢ were used for the PCR amplification of the C- terminal region of ... screening procedures to take into account the conditions found in the cell cytoplasm and to allow the selection of binders of sufficient affinity for interacting with their target in the crowded cellular...
- 14
- 483
- 0
Tài liệu Báo cáo khoa học: Quantitative estimation of channeling from early glycolytic intermediates to CO2 in intact Escherichia coli pdf
... experiments aimed at calculating the fraction of the flux from early glycolytic intermediates to CO2 in intact Escherichia coli Cells incubated with [1 4C] glucose made 1 4C- labeled glycolytic intermediates ... [17] result in data that could be used to calculate the quantitative importance of channeling in a speci c pathway They used Chinese hamster ovary cells in studies of channeling of aminoacyl-tRNA ... to neglect Catabolism of glucose via the OPPP results in CO2 being evolved from the C- 1 position of glucose When glucose is catabolized completely to CO2 in either the TCA cycle or by a branch...
- 10
- 438
- 0
Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf
... its inhibition and hemagglutinatin study The lectin is unique from that of other sialic acidspeci c lectins O-Acetyl sialic acid -speci c lectin was Ó FEBS 2003 A sialic acid speci c lectin from ... erythrocytes The binding speci city of crab lectin Inhibition studies with various sugars was helpful in deducing the binding speci city of the lectin Fucose and lactose inhibited HA activity of ... studying immunofluorescence and staining of tissue sections [51,67] Clinical trials to inhibit cancer metastasis and bacterial infections by blocking speci c glycoconjugate on the target cell...
- 8
- 616
- 0
A Review of the Medical Benefits and Contraindications to Breastfeeding in the United States ppt
... respiratory infections such as the common cold Infections of the urinary tract or other specific closed systems such as the reproductive tract or gastrointestinal tract not pose a risk for excreting ... Breastfeeding* Drug Reference Reported Effect or Reasons for Concern Amphetamine † Cocaine Heroin Marijuana Nicotine (smoking) Phencyclidine Irritability, poor sleeping pattern† Cocaine intoxication ... American Academy of Pediatrics Committee on Drugs , American Academy of Pediatrics associating nicotine from breastmilk with infant health problems, according to the Institute of Medicine Subcommittee...
- 40
- 816
- 1
Báo cáo khoa học: Proteomic identification of all plastid-specific ribosomal proteins in higher plant chloroplast 30S ribosomal subunit PSRP-2 (U1A-type domains), PSRP-3a/b (ycf65 homologue) and PSRP-4 (Thx homologue) doc
... CGGTGGCGACGACTCCTGGAGCCC-3¢; PR, 5¢-CG GGATCCCAACTGGTAATGGTAGCGACCGGC-3¢; P2-1, 5¢-ATGGAYATHGCIACIACICARGC-3¢; P2-2, 5¢-TAGCAACTCATTCGTCACTGTC-3¢; P2-3, 5¢-GGA ATTCTAGATATCGTCGACAATTTGTGTTACTACC ... 5¢-CAGATAGGAAGAGGG GCAAGGA-3¢; P4-3, 5¢-GGAATTCTAGATATCGTC GACTTATCTTCAGAACTTGTTGC-3¢; P4-4, 5¢-GGA ATTCGTCGACGCGTTTTTCAACAAATCATCATAT A-3¢; TAG1, 5¢-GGAATTCTAGATATCGTCG-3¢; TAG2, 5¢-GGAATTCGTCGACGCG-3¢ Computer ... FEBS 2003 Chloroplast -speci c ribosomal proteins (Eur J Biochem 270) 193 Table Characteristics of chloroplast -speci c ribosomal proteins (spinach) Protein name Subunit location Chain length PSRP-1...
- 16
- 528
- 0
Báo cáo khóa học: Structural and functional comparison of 15S- and 15R-specific cyclooxygenases from the coral Plexaura homomalla potx
... identical with the COX sequence from the same coral species collected in the Florida Keys forming 15R-configuration products (Fig 1) Similar to the 15R -speci c COX, all amino acid residues shown to ... Sf9 cells (A) Structures of PGF2a and 15R-PGF2a (B) TLC separation of incubation products Incubations of [1-1 4C] arachidonic acid with recombinant coral COX proteins were carried out as described ... stabilization of the carboxyl half of arachidonic acid to promote proper positioning of C- 9 with respect to C- 11, necessary for cyclopentane ring formation Ovine COX-1 mutants in which Val349 was replaced...
- 6
- 414
- 0
Báo cáo khoa học: NMR and MS evidences for a random assembled O-specific chain structure in the LPS of the bacterium Xanthomonas campestris pv. Vitians A case of unsystematic biosynthetic polymerization potx
... added by the glycosyl transferases to the nonreducing end of the acceptor chain at the cytoplasmic face [20] In some cases a single enzyme catalyses the formation of more linkages and this, of course, ... reflected in the chemical shifts of C1 of Fuc3NAc, which is downfield in comparison to the other fragments A change in the / and w angles has been shown to give rise to a difference in the chemical ... the cluster of ions originating from octasaccharides contained ions from sodium adducts of Rha8, Rha7Fuc3NAc, Rha6(Fuc3NAc)2 and Rha5(Fuc3NAc)3, whereas the sodium adduct ions of Rha10Fuc3NAc,...
- 9
- 454
- 0
Báo cáo hóa học: " Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R in whole blood" pptx
... presence or absence of Ab-01 This protocol mimicked the conditions of the intended clinical use of the assay, since blood from Ab-01 treated subjects (containing Ab-01) would have to placed in a ... collection Adult cynomolgus monkeys (Macaca fascicularis; Charles River BRF, Inc, Houston, TX) weighing to kg were singly or pair housed and cared for according to the American Association for Accreditation ... development of p38 MAPK inhibitor compounds [7] in which LPS (lipopolysaccharide)-induced production of inflammatory cytokines can be measured We followed this basic approach (ex vivo stimulation of whole...
- 13
- 528
- 0
Charade of the Debt Crisis From Buffoonery to Tragedy in the Debt Folly and Euro Farceby pptx
... risk of flighty currencies faced by locals as well as foreigners To wit, all types of actors in both the private and public sectors have to deal with the uncertainty linked to the incessant churn ... average level of prices within Greece turns out to be compatible with the innate levels of productivity and income The objects in this category include input factors such as the cost of labor as ... problem of wealth destruction in the entire economy due to the long-running custom of misguided policies in the public sector The meddling of the politicians in favor of the worst speculators gave...
- 36
- 572
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008