searching a process s memory for unreferenced malloc buffers
programming mac os x a guide for unix developers 2003
Ngày tải lên :
24/04/2014, 09:17
... tools 156 ps (process status) and top (system usage statistics) 156 sc_usage: showing system call usage statistics 158 fs_usage: reporting system calls and page faults related to the filesystem ... commands mapped to Mac OS X commands 307 OpenSSH: ssh, scp B.4 307 s Talk to another user: talk, ytalk UNIX process management commands mapped to Mac OS X commands 307 Show system and process usage ... provides access to application help s Status items appear as the final, rightmost menu item and display information about system services, enabling quick access to system settings NOTE Clipboard is...
- 385
- 909
- 0
Sandboxes and Tar pits
Ngày tải lên :
19/10/2013, 00:20
... change the password immediately and send a new password to that user Captured passwords can also be used to populate a list of unsafe passwords that may not be used to access your application The ... authentication attempts from a particular IP address Most dictionary-based attacks are conducted and guided by an automated script, which uses a large database of words to guess login names and ... the attacker access, the entire range of addresses can be blocked Such action ensures that users without dedicated IP addresses—users whose address may change between connections—can be successfully...
- 13
- 276
- 0
Tài liệu Part 22 - Hardware Profiles - Shadow Copies - Compress - Disk Quota docx
Ngày tải lên :
17/12/2013, 06:15
... lượng s dụng User Nhấp phải vào ổ đ a có ch a thư mục Share chọn Properties of 19 Chọn Tab Quota nhấp chọn: - Enable quota management: Bật Quota - Deny disk space to users exceeding quota limit: ... tính Compress cho thư mục bạn nhấp phải vào thư mục Data chọn Properties Click chọm Compress contents to save disk space of 19 Bây bạn thấy thư mục Data có màu xanh bật thuộc tính file AC Xem lại ... Compress.dll thấy 1.12Mb mà of 19 Disk Quota Ở trước phần Share Permission biết cách tạo thư mục chia s tài nguyên gán quyền cho User s dụng tài nguyên thư mục Share Tuy nhiên thực tế Share cho...
- 19
- 485
- 4
Tài liệu Part 22 - Hardware Profiles - Shadow Copies - Compress - Disk Quota pptx
Ngày tải lên :
23/01/2014, 06:20
... lượng s dụng User Nhấp phải vào ổ đ a có ch a thư mục Share chọn Properties of 19 Chọn Tab Quota nhấp chọn: - Enable quota management: Bật Quota - Deny disk space to users exceeding quota limit: ... tính Compress cho thư mục bạn nhấp phải vào thư mục Data chọn Properties Click chọm Compress contents to save disk space of 19 Bây bạn thấy thư mục Data có màu xanh bật thuộc tính file AC Xem lại ... Compress.dll thấy 1.12Mb mà of 19 Disk Quota Ở trước phần Share Permission biết cách tạo thư mục chia s tài nguyên gán quyền cho User s dụng tài nguyên thư mục Share Tuy nhiên thực tế Share cho...
- 19
- 189
- 0
Does the Alberta Tar Sands Industry Pollute? The Scientific Evidence ppt
Ngày tải lên :
23/03/2014, 04:20
... Parrott J, Sherry J, McMaster M Fish health effects from oil sands wastewater discharges and naturally- occurring oil sands compounds in the Athabasca River system Task Assessment of natural and ... Gentes M-L Health assessment of tree swallows (Tachycineta bicolor) nesting on Athabasca oil sands, Alberta MSc Thesis, University of Saskatchewan 2006 Ronconi RA, St Clair CC Efficacy of a radar-activated ... tremuloides) forests on fine-textured Gray Luvisolic upland soils; jack pine (Pinus banksiana) forests on sandy Brunisolic uplands; riparian balsam poplar (Populus balsamifera) forests and Timoney and...
- 17
- 396
- 0
Báo cáo khoa học: "Jointly Learning to Extract and Compress" docx
Ngày tải lên :
23/03/2014, 16:20
... extractive and compressive solver against size of intermediate extraction set Also shown are values for an LP relaxation approximate solver, a solver that is restricted to extractive solutions, and finally ... of former Ambassador Joseph Wilson, was an undercover CIA agent Wilson was a critic of the Bush administration Administration staffers Karl Rove and I Lewis Libby are the focus of the investigation ... representation of compressive summaries Assume a constituency parse ts for every sentence s We represent a compressive summary as a vector y = (yn : n ∈ ts , s ∈ x) of indicators, one for each...
- 10
- 392
- 0
Báo cáo sinh học: " Phosphorylation of HIV Tat by PKR increases interaction with TAR RNA and enhances transcription" potx
Ngày tải lên :
18/06/2014, 22:20
... T64 S6 8 S6 2.T64 T64 .S6 8 S6 2 .S6 8 S6 2.T64 .S6 8 Tat b S6 2A M C Tat Tat Tat Tat T6 4A M C Tat Tat Tat S6 8A M C Tat Tat S6 2A. T6 4A M C Tat Tat Tat T6 4A. S6 8A M C Tat Tat Tat Tat Tat S6 2A. S6 8A M C Tat Tat ... - S A S S A S A A 64 - C Q Q Q Q Q Q Q Q - T T A T A A T A Tat 68 - H H H H H H H H Tat - Q Q Q Q Q Q Q Q - A A A A A A A A - S S S A S A A A - L L L L L L L L - S S S S S S S S - Wild-type S6 2 ... were available Scanning densitometry and non-linear regression analysis was performed and the extent of phosphorylation after 15 minutes was measured for each protein and expressed as a percentage...
- 13
- 410
- 0
báo cáo hóa học:" Phosphorylation of HIV Tat by PKR increases interaction with TAR RNA and enhances transcription" ppt
Ngày tải lên :
20/06/2014, 04:20
... T64 S6 8 S6 2.T64 T64 .S6 8 S6 2 .S6 8 S6 2.T64 .S6 8 Tat b S6 2A M C Tat Tat Tat Tat T6 4A M C Tat Tat Tat S6 8A M C Tat Tat S6 2A. T6 4A M C Tat Tat Tat T6 4A. S6 8A M C Tat Tat Tat Tat Tat S6 2A. S6 8A M C Tat Tat ... - S A S S A S A A 64 - C Q Q Q Q Q Q Q Q - T T A T A A T A Tat 68 - H H H H H H H H Tat - Q Q Q Q Q Q Q Q - A A A A A A A A - S S S A S A A A - L L L L L L L L - S S S S S S S S - Wild-type S6 2 ... were available Scanning densitometry and non-linear regression analysis was performed and the extent of phosphorylation after 15 minutes was measured for each protein and expressed as a percentage...
- 13
- 324
- 0
Báo cáo hóa học: "Research Article End-to-End Joint Antenna Selection Strategy and Distributed Compress and Forward Strategy for Relay Channels" potx
Ngày tải lên :
21/06/2014, 20:20
... of antennas of each relay stage is chosen for transmission that has the maximum mutual information at the destination We showed that the JEEMAS strategy can achieve the maximum diversity gain and ... that we assumed that |Skn | = m, that is, equal number of antennas are selected at each relay stage The justification of this assumption is as follows Let us assume that Mn , n = 0, 1, , N antennas ... relay messages After compression, each relay transmits the message to the destination using the strategy for multiple access channel with correlated messages [33], since the relay compressed...
- 12
- 328
- 0
Báo cáo y học: " Lentiviral transduction of Tar Decoy and CCR5 ribozyme into CD34+ progenitor cells and derivation of HIV-1 resistant T cells and macrophages" pdf
Ngày tải lên :
10/08/2014, 05:20
... purposes) AIDS Research and Therapy 2004, 1:2 http://www.aidsrestherapy.com/content/1/1/2 Figure FACS analysis of transgenic macrophages for the CD14 surface marker and EGFP expression FACS analysis ... Hayes-Klug for assistance with SCID-hu mouse surgeries, Karen Helms for help with FACS and Joe Anderson for critically reading the manuscript We thank NIH AIDS Research and Reference Reagents Program ... findings of Boden et al [14] These obstacles can be overcome by the use of combinatorial constructs against multiple targets in the viral genome as well as cellular targets that assist in viral infection...
- 11
- 264
- 0
Báo cáo khoa học: " A dual function TAR Decoy serves as an anti-HIV siRNA delivery vehicle" pot
Ngày tải lên :
12/08/2014, 04:21
... ctaccacagatctgagcctggga Antisense primer: ttgggcctgtgcctcttcagctaccaagaga gctcccaggctcagatctgtg Anti-TGF-b TARmiR configuration I Sense primer: Taatacgactcactata gggcatgtcatcagctggg aagacagatctgagccctggga ... TARmiR configurations or anti-HIV shRNA and siCheck plasmid having the TGF-b target site (A) or vice versa (B) Dual Luciferase assay was performed as described in Materials and Methods As seen in the ... aagacagatctgagccctggga Antisense primer: ttgggcatgtcatcagctgggaagaagaga gctcccagggctcagatctgtcttc TAR-miR-perfect stem configuration: Sense primer: Taatacgactcactata gggcctgtgcctcttca gctaccttcatctgagcctggga Antisense...
- 9
- 197
- 0
Retrovirology Research BioMed Central Open Access HIV-1 TAR miRNA protects against apoptosis by ppt
Ngày tải lên :
12/08/2014, 23:20
... cultured for 96 hours Apoptosis was measured at 96 hours after serum starvation using FACs analysis Data are representative of two experiments (B) 293T cells were transfected with siRNA against ERCC1 ... HLM-1 (lanes and 4) were Western blotted for Caspase expression and cleavage at Zero (lanes and 2) and 48 (lanes and 4) hours after serum starvation (B) CEM (lanes and 3) and ACH2 (lanes and 4) ... manufacturers instructions Primers used for PCR were: ERCC1F: GGCGACGTAATTCCCGACTA, ERCC1R: AGTTCTTCCCCAGGCTCTGC, IER3F: TCTACCCTCGAGTGGTGAGTATC, IER3R: ACTAAGGGGAGACAAAACAGGAG Results and discussion Sequencing...
- 17
- 321
- 0
Báo cáo y học: "Destabilization of the TAR hairpin leads to extension of the polyA hairpin and inhibition of HIV-1 polyadenylation" pptx
Ngày tải lên :
13/08/2014, 05:21
... unspliced kb 2 8S rRNA single spliced double spliced polyadenylation at 3’ LTR kb AAAAA (A) n 1 8S rRNA 915-939 AAAAA (A) n polyadenylation at SV40 pA 1191-1215 B 5’ AB A B 3’ AB A B AB unspliced CA-p24 (ng/ml) ... × SSC, 0.2% SDS) and two times for 10 at 50°C in high stringency buffer (0.1 × SSC, 0.2% SDS) Images were obtained using the PhosphorImager (Amersham Biosciences) and data analysis was performed ... virus type polyadenylylation signal: a 3' long terminal repeat element upstream of the AAUAAA necessary for efficient polyadenylylation Proc Natl Acad Sci USA 1991, 88:2108-2112 Valsamakis A, Schek...
- 9
- 241
- 0
Báo cáo y học: " A real-time view of the TAR:Tat:P-TEFb complex at HIV-1 transcription sites" ppsx
Ngày tải lên :
13/08/2014, 05:22
... cells and at HIV-1 transcription sites Previous studies have shown that tagging RNAs with binding sites for the coat protein of phage MS2 allows its detection in living cells [11] Thus, to visualize ... and the kinase Cdk9, and Tat directly binds CycT1 (see [5] for a review) Tat also binds TAR (trans-activation-responsive region), an RNA element present at the 5' end of all HIV-1 transcripts, ... reporter was activated by Tat, several proteins accumulated at the HIV-1 transcription site, including Tat itself, and its cofactors Cyclin T1 and Cdk9 (Figure 1A and Figure 2) In contrast, this was...
- 5
- 174
- 0
Báo cáo y học: "Nuclear Factor 90(NF90) targeted to TAR RNA inhibits transcriptional activation of HIV-1" potx
Ngày tải lên :
13/08/2014, 05:22
... using a modified Bradford assay (Bio-Rad) Colorimetric β-galactosidase and CAT assays were performed as described [37] In each case β-galactosidase reporter was normalized to protein concentration ... pCMV-CAT plasmid DNA was cotransfected The final total amount of DNA in each reaction was adjusted with salmon sperm DNA After 48 hours, cell extracts were prepared and standardized for total protein ... the fact that any natural or induced mutation that destabilizes the TAR structure disrupts base pairing in the TAR stem region [44] Also loss of TAR specific secondary structure abolishes Tat-stimulated...
- 10
- 334
- 0
Báo cáo y học: " Inhibition of HIV derived lentiviral production by TAR RNA binding domain of TAT protein" pps
Ngày tải lên :
13/08/2014, 09:21
... luciferase gene expression from TAT responsive promoter by Tat-P seems less dramatic (Fig 6A) Such discrepancy was also observed previously by others using TAT responsive promoter driven CAT assay ... hours The cells were harvested hours later and processed by luciferase assay (Promega, Madison WI) and the level of luciferase activity was determined at 24 hours using an illuminometer (AutoLumat ... luciferase assay The inhibition rates were expressed as mean ± SE Panel B The RNA binding assay: 0.25 nmol of TAR RNA was incubated with Tat-P or control peptides (Con-P1 and Con-P2) at indicated...
- 11
- 256
- 0
Recent progresses in catalytic tar elimination during biomass gasification or pyrolysis
Ngày tải lên :
08/10/2015, 23:43
... Tasaka K, Furusawa T, Tsutsumi A Steam gasification of cellulose with cobalt catalysts in a fluidized bed reactor Energy and Fuels 2007;21:590 [173] Tasaka K, Furusawa T, Tsutsumi A Biomass gasification ... et al Catalytic performance and characterization of Ni–Fe catalysts for the steam reforming of tar from biomass pyrolysis to synthesis gas Applied Catalysis A: General 2011;392:248–55 [73] Asadullah ... novel nanoarchitectured Ni5TiO7/TiO2/Ti compound composite as a catalyst in a biomass gasification process have proven outstandingly active as catalysts and appear most suitable for high-temperature...
- 22
- 446
- 0
MP3 Compress algorithm
Ngày tải lên :
31/03/2016, 15:57
... last two parts of a frame have the same anatomy and consists of several subparts as shown in These two parts store particular information for each granule respectively part2_3_length big_values ... The Frame Layout A frame consists of five parts; header, CRC, side information, main data and ancillary data, as shown in Figure 5.1 Header CRC Side Information Main Data Ancillary Data Figure ... Scalefactor groups bits per channel are transmitted, one for each scalefactor band If a bit belonging to a scalefactor band is zero the scalefactors for that particular band are transmitted for...
- 45
- 367
- 0