roots of a cubic equation with solver
Đề tài " Formation of singularities for a transport equation with nonlocal velocity " potx
Ngày tải lên :
29/03/2014, 07:20
... ill-posed for general initial data A linear analysis of small perturbations of planar sheets leads to catastrophically growing dispersion relations Several attempts at regularization were introduced ... one-dimensional transport equation with nonlocal flux, Comm Appl Anal (1997), 315–336 [12] T Sakajo, On global solutions for the Constantin-Lax-Majda equation with a generalized viscosity term, Nonlinearity ... Annals of Mathematics, 162 (2005), 1377–1389 Formation of singularities for a transport equation with nonlocal velocity ´ ´ By Antonio Cordoba∗ , Diego Cordoba∗∗ , and Marco A Fontelos∗∗ * Abstract...
- 14
- 252
- 0
Báo cáo hóa học: " Research Article On Stability of a Functional Equation Connected with the Reynolds Opera" docx
Ngày tải lên :
22/06/2014, 22:20
... Isac, and Th M Rassias, Stability of Functional Equations in Several Variables, vol 34 of Progress in Nonlinear Differential Equations and Their Applications, Birkh¨ user Boston, a Boston, Mass, ... Journal of Inequalities and Applications Banach algebra Ꮽ They have shown that if a mapping f : X → Ꮽ satisfies f (x ◦ y) − f (x) f (y) ≤ (3) with some > 0, then there exist a commutative C ∗ -algebra ... Boston, Mass, USA, 1998 [2] J Acz´ l and J Dhombres, Functional Equations in Several Variables, vol 31 of Encyclopedia of e Mathematics and Its Applications, Cambridge University Press, Cambridge,...
- 3
- 216
- 0
Tài liệu Báo cáo khóa học: New activities of a catalytic antibody with a peroxidase activity ppt
Ngày tải lên :
19/02/2014, 12:20
... S-oxidation of thioanisole As the above results showed that the best system for the S-oxidation of thioanisole associated H2O2 as an oxidant with MP8 as a catalyst in the presence of tBuOH as an ... case, because an oxidative degradation of the catalyst occurred This was shown by a progressive disappearance, in its absorption spectrum, of the soret band at 396 nm that is characteristic of ... such as nitrosoalcane, to the iron of MP8, it brings a partial steric hindrance on the distal face of MP8 and thus controls access of the nitrosoalcane ligand to the iron atom of MP8 Such a phenomenon...
- 7
- 447
- 0
Đề tài " The number of extensions of a number field with fixed degree and bounded discriminant " docx
Ngày tải lên :
06/03/2014, 08:21
... (This data was obtained with the commands InvariantRing, PrimaryInvariants, and SecondaryInvariants in Magma.) One checks that R = R/f1 R is an integral domain Let S be the subring of R generated ... Bhargava, The density of discriminants of quartic rings and fields, Ann of Math 162 (2005), 1031–1063 [3] ——— , The density of of discriminants of quintic rings and fields, Ann of Math., to appear ... elementary arguments from the geometry of numbers and linear algebra Acknowledgments The authors are grateful for the hospitality of the American Institute of Mathematics, where the first phase of...
- 20
- 478
- 0
Báo cáo khoa học: Reduction of a biochemical model with preservation of its basic dynamic properties doc
Ngày tải lên :
07/03/2014, 11:20
... ADP fi ACA + ATP ACA + NADH fi NAD+ ATP fi ADP Glc + ATP fi ADP trioseP + NADH fi NAD+ ACA Ð ACA x ACAx fi GAPDH: lowpart: ADH: ATPase: storage: glycerol: difACA: outACA: V2 ½Glc½ATP 1þ ½ATP Ki ... [NAD+] k4[BPG] [ADP] k5[ACA] [NADH] k6[ATP] k7[Glc] [ATP] k8[trioseP] [NADH] k9([ACA] ) [ACAx]) (k0 + k10) [ACAx] ACA) was changed so that it is now formally composed of the ACA leaving the reactor ... six Reaction r HKa: PFK: ALD: TIM: GAPDH: lpPEP PKb: glycerol: storage: ATPase: AK: ATP fi ADP ATP fi ADP + FBP FBP Ð GAP þ DHAP DHAP Ð GAP GAP Ð BPG ADP þ BPG Ð ATP ADP Ð ATP DHAP fi ATP fi ADP ATP...
- 16
- 492
- 0
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc
Ngày tải lên :
07/03/2014, 12:20
... GLU R1 5A forward (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), ... H44 7A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU T46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3¢); ... et al Glucoamylase raw starch binding site reverse (5¢-GTTCATTCAAGGAGCCATCAGCATTAAT AGCATCCAAAATGACTTGC-3¢) All mutations were verified by DNA sequencing Glucoamylase Glu Enzyme preparation and...
- 11
- 548
- 0
báo cáo hóa học:" Meaning in life in the Federal Republic of Germany: results of a representative survey with the Schedule for Meaning in Life Evaluation (SMiLE)" ppt
Ngày tải lên :
20/06/2014, 16:20
... significantly higher levels of family life satisfaction and community satisfaction [35] Inhabitants of the affluent German South-West (BadenWuerttemberg, Bavaria, Hesse/Rhineland-Palatinate/Saarland, ... spirituality and least satisfied with work and finances Health, partnership, and family were rated as most important for MiL, home/garden and leisure time were least important In multifactorial analyses ... QoL Quality of Life s1 sn satisfaction with each MiL area SEIQoL Schedule for the Evaluation of Individual Quality of Life Page of (page number not for citation purposes) Health and Quality of Life...
- 8
- 382
- 0
Báo cáo hóa học: " A fixed-point approach to the stability of a functional equation on quadratic forms" doc
Ngày tải lên :
20/06/2014, 22:20
... equation and a Jensen-quadratic equation Abstr Appl Anal 2007 (2007) Article ID 45179 Găvruta, P: A generalization of the Hyers-Ulam-Rassias stability of approximately additive mappings J Math Anal Appl ... pnas.27.4.222 Bae, J-H, Park, W-G: On stability of a functional equation with n variables Nonlinear Anal TMA 64, 856–868 (2006) doi:10.1016/j.na.2005.06.028 Bae, J-H, Park, W-G: On a cubic equation ... multidimensional functional equation having quadratic forms as solutions J Inequal Appl 2007 (2007) Article ID 24716 11 Rassias, TM: On the stability of linear mappings in Banach spaces Proc Amer Math Soc 72,...
- 7
- 429
- 0
Báo cáo hóa học: " A fixed point approach to the Hyers-Ulam stability of a functional equation in various normed spaces" pptx
Ngày tải lên :
20/06/2014, 22:20
... (2002) Kenary, HA: The probabilistic stability of a Pexiderial functional equation in random normed spaces Rend Del Circolo Math Di Palermo (to appear) Kenary, HA, Shafaat, Kh, Shafei, M, Takbiri, ... details Department of Mathematics, College of Sciences, Yasouj University, Yasouj 75914-353, Iran 2Department of Mathematics, University of Ulsan, Ulsan 680-749, Korea 3Department of Mathematics, ... |r| + |s| A field K is called a valued field if K carries a valuation The usual absolute values of ℝ and ℂ are examples of valuations In 1897, Hensel [14] has introduced a normed space which...
- 14
- 479
- 0
báo cáo hóa học: " Glrt-Based Array Receivers for The Detection of a Known Signal with Unknown Parameters Corrupted by " docx
Ngày tải lên :
21/06/2014, 00:20
... R(nT), C(nT), s TNAR available R, C on sec data TNAR available R, C on sec + prim data No TNAR No TNAR available R, C on sec data TNAR available R, C on sec + prim data No TNAR - 29 - Receivers ... estimated from secondary data only In a same way, the knowledge of a TNAR allows to increase the performance in comparison with an absence of TNAR Finally, for a given set of total noise parameters, ... [9] from a GLRT approach under a Gaussian noise assumption and assuming the total noise covariance matrix and the useful propagation channel are two unknown parameters The advantages of this detector...
- 45
- 467
- 0
báo cáo hóa học:" Research Article Complete Asymptotic and Bifurcation Analysis for a Difference Equation with Piecewise Constant Control" potx
Ngày tải lên :
21/06/2014, 11:20
... Q attracts all solutions originated from its region of attraction Advances in Difference Equations Equation 1.3 is related to several linear recurrence and functional inequality relations of ... nonlinear nature of our model at hand Indeed, we are dealing with a dynamical system with piecewise constant nonlinearlities see e.g., 2–6 , and the usual linear and continuity arguments cannot be applied ... results in terms of our phase plane model 1.21 and compare them with what we have obtained for the phase plane model of 1.1 We remark that since we need to find the exact regions of attraction, we...
- 13
- 311
- 0
báo cáo hóa học:" Research Article A Note on a Beam Equation with Nonlinear Boundary Conditions" doc
Ngày tải lên :
21/06/2014, 11:20
... function of t, thus M a, b b t∈ a, b b k t, s ds a b k a, s ds a a a a2 − 3s2 3.3 6s ds Since k is a nondecreasing function of t, we have max 0
- 14
- 276
- 0
Báo cáo hóa học: "Research Article A Fixed Point Approach to the Stability of a Functional Equation of the Spiral of Theodorus" pptx
Ngày tải lên :
22/06/2014, 11:20
... “Approximate homomorphisms,” Aequationes Mathematicae, vol 44, no 2-3, pp 125–153, 1992 11 Th M Rassias, “On the stability of functional equations and a problem of Ulam,” Acta Applicandae Mathematicae, ... Differential Equations and Their Applications, Birkh¨ user, Boston, Mass, USA, 1998 a S.-M Jung, Hyers-Ulam-Rassias Stability of Functional Equations in Mathematical Analysis, Hadronic Press, Palm Harbor, ... point approach to the stability of an equation of the square spiral,” Banach Journal of Mathematical Analysis, vol 1, no 2, pp 148–153, 2007 14 S.-M Jung and J M Rassias, “Stability of general Newton...
- 7
- 257
- 0
Báo cáo hóa học: " Whispering gallery modes in photoluminescence and Raman spectra of a spherical microcavity with CdTe quantum dots: anti-Stokes emission and interference effects" ppt
Ngày tải lên :
22/06/2014, 22:20
... of fast Fourier analysis adjacent TE and TM modes) again in agreement with measured modes separation (Fig 3a) Periodicities of 0.44 and 0.33 nm, obtained from the Fourier analysis, are indicative ... allow a comparison with the experimental data The spacing is measured between the first and the second peak, respectively, of two adjacent pairs The analytical equation using expansions of the Bessel ... observation of ASPL from a PS microsphere with a single layer of CdTe QDs which have an order of magnitude lower quantum efficiency than the colloidal dots can be attributed to the optical feedback...
- 6
- 329
- 0
ON WEAK SOLUTIONS OF THE EQUATIONS OF MOTION OF A VISCOELASTIC MEDIUM WITH VARIABLE BOUNDARY V. G. pptx
Ngày tải lên :
23/06/2014, 00:20
... approximation of the equation in a weak sense and application of the topological theory of a degree that allows to establish the existence of solutions on the basis of a priori estimates and statements ... hydrodynamics, ı ı “Nauka”, Moscow, 1989 O A Ladyˇ enskaja, An initial-boundary value problem for the Navier-Stokes equations in doz mains with boundary changing in time, Zap Nauˇ n Sem Leningrad ... Zvyagin: Department of Algebra and Topological Methods of Analysis, Faculty of Mathematics, Voronezh State University, Universitetskaya pl 1, 394006 Voronezh, Russia E-mail address: zvg@main.vsu.ru...
- 31
- 266
- 0
Báo cáo toán học: "Note on generating all subsets of a finite set with disjoint union" potx
Ngày tải lên :
07/08/2014, 21:21
... family G ⊂ P[n] a k-base of P[n] if every x ⊂ [n] can be expressed as a union of at most k sets in G; they conjectured that for any k ≤ n, any k-base of P[n] is at least as large as Fn,k ... generalization of a theorem of Alon and Frankl, proved via an Erd˝s-Stone o type result As observed in [1], for a k-generator G, we have the following trivial bound on |G| = m The number of ways of ... Nikiforov (a slight weakening of Theorem in [4]): Theorem Let a ≥ 2, ca log n ≥ Then any graph on n vertices with at least cna Ka ’s contains a Ka (t) with t = ⌊ca log n⌋ We see that provided...
- 6
- 215
- 0
Báo cáo toán học: "A Decomposition Algorithm for the Oriented Adjacency Graph of the Triangulations of a Bordered Surface with Marked Point" potx
Ngày tải lên :
08/08/2014, 14:23
... a signed adjacency matrix associated to an ideal triangulation of a bordered surface with marked points (S, M), and G is a quiver If B(G) = B, we say G is the oriented adjacency graph associated ... to a triangulation of a bordered surface with marked points is finite (Corollary 12.2 in [2]) It is also proved in [2] that an integer matrix B is an adjacency matrix of an ideal triangulation of ... blocks Each elementary block is uniquely associated to a triangulation of a piece of surface Gluing elementary blocks corresponds to a gluing of associated triangulated pieces of surfaces along arcs...
- 45
- 262
- 0
Báo cáo toán học: "Chromatic Roots of a Ring of Four Cliques" potx
Ngày tải lên :
08/08/2014, 14:23
... showing that all roots of Wa,p,q,n (z) are actually the eigenvalues of a symmetric matrix with real entries only Assume that p, q, n are arbitrary real numbers with p ≤ q ≤ n and p + q ≥ For any positive ... Combinatorics and Statistical Mechanics (January-June 2008), where this work was started and partially finished References [1] Peter J Cameron, Algebraic Properties of Chromatic Roots, Available ... investigation of the algebraic properties of chromatic roots (Cameron [1]) and in the course of this investigation, the chromatic roots of many of these graphs were computed When the chromatic roots...
- 13
- 225
- 0
báo cáo khoa học: "Kaposiform hemangioendothelioma in tonsil of a child associated with cervical lymphangioma: a rare case report" pptx
Ngày tải lên :
09/08/2014, 01:24
... hemangioma [11] A similar coexistence of lymphangiectasia with vascular tumor nodules is seen in a tufted angioma KHE and tufted angioma are probably same part of the spectrum Cases of an acquired ... lack of nuclear atypia and mitosis within tumor cells, along with HHV8 negativity This reinforces lack of a common pathway for a Kaposiform hemangioendothelioma and a Kaposi’s sarcoma In spite of ... Author details Department of Pathology, Tata Memorial Hospital, Parel, Mumbai Department of Radiodiagnosis, Tata Memorial Hospital, Parel, Mumbai Authors’ contributions BR: Diagnosing pathologist,...
- 8
- 471
- 0
Báo cáo y học: "Identification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodies" ppsx
Ngày tải lên :
09/08/2014, 06:22
... dimethylated arginine residues for epitopes assay Assay performance characteristics of the anti-SmD3 peptide (SMP) assay (a) Intra-assay and interassay variability, (b) linearity, and (c) receiver operating ... peptide-based assay (99.8%; data not shown) Further studies are in progress to compare the assay performance of the anti-SMP assay with that of other commercially available anti-Sm immunoassays For ... http://arthritis-research.com/content/7/1/R19 (ANA) profile (Pharmacia Diagnostics; cutoff ratio 1) The latter assay contains the autoantigens U1-68 kDa, U1 -A, U1-C, SmBB', SmD, Ro-52, Ro-60 and La All ELISAs were performed in accordance...
- 11
- 593
- 0