role of the t tubules in the response of cardiac ventricular myocytes to inotropic interventions
Báo cáo khoa học: "The role of cardiac troponin I as a prognosticator in critically ill medical patients: a prospective observational cohort study" ppt
Ngày tải lên :
12/08/2014, 22:22
... shown in this study The sample size was rather small (58 patients), however, and the majority of patients had sepsis (88%), which limits the interpretation of these results In contrast to these studies, ... cTnI does not independently contribute to the prediction of 28-day mortality beyond that provided by APACHE II Competing interests The authors declare that they have no competing interests Authors' ... admission Even though the time course and kinetics of cTnI and its relation to outcome may be of interest, the main purpose of our study was to determine whether early cTnI elevation is of clinically...
- 6
- 452
- 0
Báo cáo khoa học: Dual role of Nbs1 in the ataxia telangiectasia mutateddependent DNA damage response ppt
Ngày tải lên :
16/03/2014, 13:20
... breaks in ATM activation in vitro, suggested the possibility that the status of ATM or cofactors might determine the effect of DNA strand ends on ATM activity The situation has been clarified by the ... recruitment of ATM to sites of DNA strand breakage [23] Surprisingly, mutation of the autophosphorylation site of ATM (Ser1981 to alanine) affected neither the dimer -to- monomer transition of ATM ... binding to Mre11 during formation of the Mre11–Rad50–Nbs1 (MRN) complex The ATM-binding domain at the COOH-terminus binds to ATM and mediates recruitment of ATM to IR-induced foci showed that...
- 7
- 384
- 0
Báo cáo khoa học: The yeast stress response Role of the Yap family of b-ZIP transcription factors The PABMB Lecture delivered on 30 June 2004 at the 29th FEBS Congress in Warsaw potx
Ngày tải lên :
30/03/2014, 16:20
... is in contrast to the results obtained by Wysocki et al [10] and may be due to the fact that the latter use a multicopy vector, whereas the former look at the green fluorescent protein construct ... because of their capacity to jointly modulate the expression of a large battery of unrelated genes in response to a shift to suboptimal growth conditions Regulation is mediated by the binding of these ... at the protein level with almost 33% identity 2643 Yap proteins and the yeast response to stress C Rodrigues-Pousada et al computational interactome data that predict their interaction [63] Interestingly,...
- 9
- 346
- 0
Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt
Ngày tải lên :
31/03/2014, 01:20
... inhibited by the tyrosine kinase inhibitor tyrphostin (2.5 lM) but not by the protein kinase C inhibitor bisindolylmalamide (1 lM) (data not shown) This suggests that the signaling pathway from the IFN-c ... 0.05 inhibits LPCAT but does not affect LPAAT or CoAindependent AT activities at this concentration (M J Finnen, unpublished observations) Neither inhibitor was toxic to the cells at the concentrations ... pgÆmL)1, respectively These values reflect the relative intensity of the detected mRNA in the three samples (Fig 4) This result suggests that LPCAT inhibitors can inhibit TNF-a production in MonoMac-6...
- 7
- 322
- 0
báo cáo hóa học: " Discrimination and reliability: equal partners? Understanding the role of discriminative instruments in HRQoL research: can Ferguson''''s Delta help? A response" pptx
Ngày tải lên :
18/06/2014, 19:20
... most basic distinction, then the instrument should not be used It makes no sense to declare that an instrument has 'acceptable' reliability and interpretability, but then argue that it cannot ... be trusted to rank order people in a meaningful way This would invalidate any statistical treatment of data that failed to take measurement error into account It does not constitute an argument ... against the use of Delta It is possible, however, to incorporate these elements into the computation of a coefficient of discrimination if required As Thurlow [4] pointed out, the only discrimina-...
- 3
- 384
- 0
Báo cáo y học: "Synergistic role of c-Myc and ERK1/2 in the mitogenic response to TGF-1 in cultured rat nucleus pulposus cells" ppsx
Ngày tải lên :
09/08/2014, 01:22
... growth under TGF1 stimulation Therefore, treatment with TGF1 should yield different effects depending on the status of these mediators in the target cells 11 12 13 Competing interests The authors ... the target gene, the interruption of their association inhibits the transcriptional function of c-Myc [21] Secondly, to suppress expression of c-Myc in protein level, we tested an inhibitor of ... correlates with the mitogenic response of the cells to TGF1 stimulation To investigate the effects of c-Myc on cell growth under TGF1 stimulation, we inhibited c- Page of 12 (page number not for...
- 12
- 535
- 0
Báo cáo y học: "The role of T cell interleukin-17 in conducting destructive arthritis: lessons from animal models" pps
Ngày tải lên :
09/08/2014, 06:22
... cytokine therapy might be an interesting new antirheumatic approach that could contribute to the prevention of joint destruction as an adjunct to anti-TNF and anti-IL-1 therapy Competing interests ... (IL-17) in relation to other key cytokines in the pathogenesis of arthritis RANKL, receptor activator of NF-κB ligand; TNF, tumor necrosis factor inactivation of IL-17 [40] In line with the situation ... adaptive parts of the immune system that might be an interesting target for the immunotherapy of inflammatory autoimmune diseases [26,27] Role of IL-17 in the pathogenesis of RA Regulation of IL-17...
- 9
- 294
- 0
Báo cáo y học: "The role of regulatory T cells in antigen-induced arthritis: aggravation of arthritis after depletion and amelioration after transfer of CD4+CD25+ T cells" doc
Ngày tải lên :
09/08/2014, 06:22
... the rest of the body was determined using a γ-counter Thereafter, the total radioactivity recovered per animal was calculated by adding the counts of the organs and the rest of the body (a) The ... of the T- cell compartment is still activated 14 days after intra-articular antigen challenge in the absence of Treg cells Compatible with these findings is that the production of cytokines in response ... of Treg cells [37] With this in mind, it could be interesting to investigate whether the accumulated Treg cells in patients with arthritis function properly in vivo and whether these patients...
- 11
- 440
- 0
Báo cáo y học: "The contact-mediated response of peripheral-blood monocytes to preactivated T cells is suppressed by serum factors in rheumatoid arthritis" ppt
Ngày tải lên :
09/08/2014, 07:20
... interpretation of the results HH supervised the collection of the samples as well as the design of the study SH participated in the design of the study and in its coordination, and participated in the ... the serum protein ApoA-1 To analyse the contribution of ApoA-1 to the inhibitory activity Direct cell–cell contact of monocytes/macrophages with preactivated T lymphocytes leads to the secretion ... participated in the interpretation of the results UW designed the study, participated in its coordination, participated in the interpretation of the results, and drafted the manuscript All authors read...
- 11
- 518
- 0
Báo cáo y học: "A role of ygfZ in the Escherichia coli response to plumbagin challenge" pdf
Ngày tải lên :
10/08/2014, 05:21
... contribute to resisting the plumbagin’s toxicity When tested with plumbagin at 100 μg per disc, the inhibition zone of the ΔygfZ strain was apparently greater than that of the ΔsodA strain (Table ... AGATCTCTCTTCGAGCGAATACGGCAGC PsodAF GGACTTATGAGCTATACCCTGCCATC PsodAR GGATCCTTTTTTCGCCGCAAAACGTA pQE-ygfZ pQE-sodA PkpygfZF CCATGGGTATGGCTTTTACACCTTTTCC pQE-Kp_ygfZ PkpygfZR AGATCTATTTTCTTCCAGCGAATACGGC ... whereas no effect was seen with the other strains The MICs of the bacteria toward plumbagin were then determined The MIC of the parental strain was expectedly much higher than those of the ΔygfZ and...
- 13
- 440
- 0
Báo cáo y học: " The role of γδ T cells in airway epithelial injury and bronchial responsiveness after chlorine gas exposure in mice" pps
Ngày tải lên :
12/08/2014, 15:20
... contribution of γδ T cells to epithelial regeneration in the intestine is not evident in the airways Competing interests The author(s) declare that they have no competing interests Authors' contributions ... T cell deficient mice Our findings are consistent with a role of γδ T cells in determining the magnitude of the inflammatory response to acute epithelial injury and in maintaining and repairing ... secondary to neutrophil activation could contribute to the extent of shedding [15] The latter mechanism seems less likely since the inflammatory response to epithelial damage was also attenuated in the...
- 11
- 300
- 0
Báo cáo y học: " Role of the C-terminal domain of the HIV-1 glycoprotein in cell-to-cell viral transmission between T lymphocytes" potx
Ngày tải lên :
12/08/2014, 23:23
... Western blot: the top part of the filter has been probed with gp120 antibodies, the middle part with gp41 mAb, Chessie against the Env C-terminal tail (truncated in HIV-Env-Tr712) and the bottom ... support the view that there is a functional interaction between the Env-CT and the viral matrix protein (MA) This interaction appears to be involved in a number of processes Thus, in released immature ... dictate to which extent HIV-1 spread depends on the Env-CT Competing interests The authors declare that they have no competing interests Authors' contributions VB, VE and OTF designed the study,...
- 11
- 218
- 0
Báo cáo y học: " The role of the humoral immune response in the molecular evolution of the envelope C2, V3 and C3 regions in chronically HIV-2 infected patients" pdf
Ngày tải lên :
13/08/2014, 05:21
... than in HIV-1 infection Still, little is known about the role of humoral immunity in the evolution of the HIV-2 env gene In the present study we analyze, for the first time, the molecular evolution ... decade in Senegal The short term follow-up and the associated modest variation in the number of CD4 + T cells might have prevented the detection of this type of association in our patients Strikingly, ... contributing significantly to the high within-patient nucleotide divergence rate [22,63] The conservation of the V3 region in vivo implies that in HIV-2, as in HIV-1, this region is submitted to...
- 12
- 308
- 0
Báo cáo y học: " The role of cyclin D2 and p21/waf1 in human T-cell leukemia virus type 1 infected cells" potx
Ngày tải lên :
13/08/2014, 13:20
... terminus [20] p21/waf1 (mut) is mutated at the N-terminus and is therefore still able to bind to cyclins through the C-terminus, making this protein a possible transdominant mutant Finally, to ... associated kinase activity in HTLV-1 infected cells by binding to p16/INK4A, resulting in the inability of p16/INK4A to effectively inhibit cyclin D/ cdk4,6 complexes [57,58] The interaction of Tax ... E2F is then free to bind to the cyclin E promoter and activate transcription of cyclin E Cyclin E is expressed late in the G1 phase and helps to regulate the transition into the S phase Cyclin D...
- 17
- 299
- 0
Báo cáo y học: "A genome wide analysis of the response to uncapped telomeres in budding yeast reveals a novel role for the NAD+ biosynthetic gene BNA2 in chromosome end protection" doc
Ngày tải lên :
14/08/2014, 21:20
... TGGCCGAACTACTTGGTAGG 1281 BNA2 3' 1249 YKL161CR GCAATGTTTCCTCAGGTGGT GTAACCAGTACGAAAAAAGATA CATTT 1165 MSC1F TCTTCGGATCACCCAGTTTC 1278 NPT1 5' 1166 MSC1R G AAGCCTTAGCGTCGTCAAC CATTGTGATTTTATTCAATGTTT ... feature of the response to telomere damage A major feature of the response to telomere damage in cdc131 strains and to the absence of telomerase is the induction of genes involved in the ESR Telomerase ... GGCCAAATCGATTCTCAAAA 1367 PAC2F AATAACGAATTGAGCTATGACACCAA 1368 PAC2R AGCTTACTCATATCGATTTCATACGACTT 1172 BUD6F CAGACCGAACTCGGTGATTT 1173 BUD6R TTTTAGCGGGCTGAGACCTA 1163 HSP12F AAGGTCGCTGGTAAGGTTCA 1164...
- 17
- 432
- 0
THE REGULATORY ROLE OF MATRIX METALLOPROTEINASES IN T CELL ACTIVATION
Ngày tải lên :
24/08/2014, 11:37
... These enzymes are in an inactive state due to the thiol (SH-) group of the cysteine residue within the pro-domain interacting with the Zn2+ ion in the catalytic domain Disruption of this cysteine-zinc ... complex that consists of TGF-β latent-associated protein, and latent TGF-β-binding protein (30) MMP-2 cleaves the proinflammatory molecule monocyte chemoattractant 12 protein (MCP-3) into a truncated ... domain situated in the hinge region which is ~75 amino acid residues in length (23-26) It is of interest to point out that in the gelatinases, collagen binding is conferred by the fibronectin type...
- 202
- 322
- 0
A STUDY ON THE ROLE OF USING VIETNAMESE IN TEACHING ENGLISH VOCABULARY TO THE 10TH FORM ETHNIC MINORITY STUDENTS AT VUNG CAO VIET BAC HIGH SCHOOL -Nghiên cứu về vai trò của việc sử dụng Tiếng Việt trong dạy từ vựng Tiếng Anh cho học sinh dân
Ngày tải lên :
30/03/2015, 14:00
... the thesis with the aims that inspired her to conduct the study as well as the research questions The author also presented the scope of the study that the thesis‟s focus was the role of Vietnamese ... teachers often pay the most attention to when they introduce to their students Different methods have different focus on the aspects of vocabulary to teach As the authod stated before one of typical ... obvious that once students can the translation exercises, they certainly understand the meaning of the words and how to use the words to make sentences Thanks to that they directly learn the meaning...
- 60
- 777
- 0
The role of CD8 t cells in the differentiation of TNF iNOS producing dendritic cells and TH1 responses
Ngày tải lên :
09/09/2015, 18:58
... helper-dependent cytotoxic responses In particular, pre-stimulation of DCs with anti-CD40 in vitro, or the injection of anti-CD40 antibodies into helper T- cell deficient mice, restored the ability of DCs to ... the inability of these cells to migrate into inflamed tissues in CCR2-/- mice is detrimental to the host; although it may also be protective in certain circumstances as seen in dengue virus infections ... diversification of the CD4 T- cell effector repertoire than that encompassed by the Th1/Th2 paradigm New studies that link the 29 Chapter 1: Introduction cytokines IL-23 and IL-17 to immune pathogenesis...
- 279
- 365
- 0