rf 6a cell vegf expression at the hypoxic condition
Báo cáo khoa học: Insulin resistance in human adipocytes occurs downstream of IRS1 after surgical cell isolation but at the 1 level of phosphorylation of IRS1 in type 2 diabetes pot
... know the details of the molecular dysregulation in the target cells of the hormone Studies of cells from patients with the disease and nondiabetic subjects have demonstrated that mutations in the ... rat and mouse [26] cells The insulin-sensitivity for phosphorylation of the insulin receptor and the immediate downstream mediator IRS1 was not measurably affected by the surgical cell isolation ... subjects and type diabetic patients after overnight incubation Cells were incubated overnight and then with the indicated concentration of insulin for 10 before whole -cell lysates were subjected to...
- 11
- 472
- 0
Báo cáo y học: " Placenta growth factor and vascular endothelial growth factor B expression in the hypoxic lung" docx
... absence of VEGFA increased the rate of wound healing Thus the effects of these two proteins depend critically on their relative concentrations Further insights into the relationship between VEGFA ... VEGFA, VEGFB and PlGF, and their receptors, VEGF R1 and VEGF R2, during the development of hypoxic PH The interactions of VEGFA, VEGFB and PlGF on human pulmonary microvascular endothelial cells ... VEGFA protein expression in control and hypoxic rat lung Characteristic western blots for VEGFA and GAPDH There were no alterations in protein expression of the VEGF ligand in the hypoxic lung...
- 13
- 335
- 0
Báo cáo y học: "Effects of Losartan on expression of connexins at the early stage of atherosclerosis in rabbits"
... demonstrated that rats lack of Cx43 expression showed 50% lower rate of attack with atherosclerotic plaque compared with normal rats (9) Our study demonstrates an association of the formation of atherosclerosis ... in the high fat diet group than in the normal group Vessel wall is in the condition of rugosity and the yellow atheromatous plaques were found in the lumens of high fat diet group However, the ... connections The present study aimed to detect the expression of Cx40 and Cx43 in the artery at early stage of high fat diet induced atherosclerosis and to investigate the effects of AT1 antagonist...
- 8
- 467
- 0
Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx
... ATTTCCTCATTCCAATAATG TTGAACTACGATCCAGAAGC GGATCCTCATTGAGAACAATTTCCTTGA GGATCCATCATGTTCTCATCATCATAATATG GGATCCGTTAAATATAATGCAGTGACGAAGATA GGATCCAAGTCAAACCTTGAGAAAGAACGA CACGGCATATTATGATGATGAGAACATGATGGATCTCG ... ATCCAAACTTATAATATTAAAAAAAGCGCTACTTATATGCATCATTTCATGAATTCGAGCTCGTTTAAAC GCACTAGTATGAAAAGAATAAGATCGCTTT GCCCCGGGATCATTGAGAACAATTTCC GCGGATCCGTATGACCACATTCTATACTGA GAGCCAATATCAAATCTGGTGGTAATCC GAGGAACAAAAATAGTACCGGTAATAAC ... TCAGGAACATCGTATGGGTA CATTATTGGAATGAGGAAA ATGACGTTCCAGATTACGCT AAAAGAATAAGATCGCTT TTACCGGTACTATTTTTGTTCCTCAAACTAGGAG GTATGACCACATTCTATACTGAGAAGAGTGCCTATATAAATCATCGTCAGGTAAAGAGCCCCATTATCTT GGGACGTCATACGGATAGCCCGCATAGTCAGGAACATCGTATGGGTACATGGGTTTTTTCTCCTTGACG...
- 15
- 475
- 0
Tài liệu Báo cáo khoa học: Restricted localization of proline-rich membrane anchor (PRiMA) of globular form acetylcholinesterase at the neuromuscular junctions – contribution and expression from motor neurons doc
... showing the lumbar region of the spinal cord (left) The dorsal horn and ventral horn are indicated The right panel shows PRiMA staining in the lumbar region on the same scale at low magnification The ... NMJs, we analyzed the effect of denervation on the localization of PRiMA The NMJs of the denervated tibialis and sham-operated muscle were stained for PRiMA, together with the postsynaptic marker ... addition, the decrease in PRiMA and AChE expression in the rat spinal cord after section of the sciatic nerve could be the consequence of trauma or of the loss of retrograde influence from the muscle cells...
- 12
- 488
- 0
Tài liệu Báo cáo khoa học: It is all about resolution Meeting report based upon presentations at the 10th International Global BioMillennium 2006 symposium on molecular cell biology (Tbilisi, Georgia) docx
... calmodulin-regulated and Ser ⁄ Thr kinases, activate signaling pathways that lead to cell death through membrane blebbing and autophagic cell death Two closely related kinases, ZIPk and DRP-1, mediate trans-phosphorylation ... Post-translational regulation was discussed by Aaron Ciechanover (Haifa, Israel), who argued that the ubiquitin proteolytic system covers the pathway for elucidating the basic mechanisms that are ... analysis of the human cell cycle in primary cells Combining microarray expression data with precise measurements of the culture synchrony at each time point enables deconvolution of the temporal expression...
- 4
- 510
- 0
Signaling at the Cell Surface in the Circulatory and Ventilatory Systems docx
... pathway, the shorter the response time When stimulation frequency is greater than a given threshold, the cell does not respond When stimulation frequencies match the cell pathway bandwidth, the ... that originate at the plasma membrane use a set of proteic and lipidic mediators (Table 1.1) These mediators either possess a catalytic function or participate in the regulation of the activity ... range The adaptation module maintains the intracellular signal at a steady state, whatever the ambient concentration of ligand, which can fluctuate However, as the behavior of signaling pathways...
- 999
- 3,169
- 0
Báo cáo khoa học: Cell type-specific transgene expression of the prion protein in Xenopus intermediate pituitary cells ppt
... with the data obtained by direct fluorescence analysis and thus indicating that the expression of the transgene product is melanotrope cell specific The steady-state levels of POMC and the putative ... Discussion The aim of the present study was to investigate the intracellular fate of PrPC by examining for the first time its biosynthesis in the secretory pathway of neuroendocrine cells in vivo and the ... glycosylated and sulfated in the Golgi apparatus The mature GFP–PrPC is presented at the plasma membrane (PM) where enzymatic cleavage occurs On the left, a schematic of the secretory pathway is depicted...
- 16
- 431
- 0
Báo cáo khoa học: Oxygen control of nif gene expression in Klebsiella pneumoniae depends on NifL reduction at the cytoplasmic membrane by electrons derived from the reduced quinone pool doc
... obtained in chlorate resistant mutants that not respire in the presence of nitrate, it is nitrate respiration, rather than nitrate per se, that abolishes nif expression [37,42] It appears that during ... reduce the FAD cofactor of purified NifL in the absence of a redox mediator (Fig 4) Taken together, these data indicate strongly that under anaerobic conditions and at a favourable quinol/quinone ratio, ... pressure cell, cell debris was sedimented by centrifugation at 20 000 g for 30 and the fusion protein was purified from the supernatant by amylose affinity chromatography All purification steps were performed...
- 12
- 488
- 0
Báo cáo khoa học: Comparison of human RNase 3 and RNase 7 bactericidal action at the Gram-negative and Gram-positive bacterial cell wall pot
... reflect their action at the outer envelope level Studies at the bacterial cell wall The bactericidal activity of both RNases is precluded by the protein binding to the cells Proteins incubated with ... for h The magnification scale is indicated at the bottom of each micrograph treatment [14], where severe damage on E coli cells and the ability of protein to trigger cell population agglutination ... microscope at ·50 magnification The agglutinating activity is expressed as the minimum agglutinating concentration of the sample tested, corresponding to the first condition where bacterial aggregates...
- 13
- 465
- 0
Báo cáo khoa học: Dynamic association of MLL1, H3K4 trimethylation with chromatin and Hox gene expression during the cell cycle ppt
... trimethylation marks were observed at the beginning of the S phase (0 h), and these marks were attenuated for the rest of the cell cycle (10 and 20 h), correlating with the expression of the gene ... slight increase in the G2 ⁄ M cell population (to 7%) in comparison with the control The MLL1 antisense-mediated increase in the cell population at the G2 ⁄ M phase indicated that knockdown of MLL1 ... H3K4 trimethylation at the HoxA5 gene promoter at the G2 ⁄ M phase was correlated with its expression profile (as shown in Fig 6A, B), indicating the importance of MLL1 and H3K4 trimethylation in HoxA5...
- 12
- 439
- 0
Báo cáo Y học: Identification of a critical lysine residue at the active site in glyceraldehyde-3-phosphate dehydrogenase of Ehrlich ascites carcinoma cell ppt
... presence of the substrates GraP or NAD or the competitive inhibitor NADH are therefore located at the substrate binding region of the EAC cell enzyme Partial sequence of the subunits of EAC cell Gra3P ... transferred along with the aliquot from the incubation medium to the enzyme assay mixture had no additional effect on the enzymatic rate These results confirm that the lysine residue(s) that reacted with ... whether TNBS binds to the lysine residue or to the SH-group of EAC cell Gra3P DH In one of these experiments, the enzyme was first inactivated by DTNB and then further treated with TNBS If both the...
- 8
- 283
- 0
Báo cáo khoa học: Mitochondrial calcium signalling in cell death Delivered on 1 July 2004 at the 29th FEBS Congress in Warsaw pptx
... alteration in ER Ca2+ handling (both the steady state levels and the release kinetics were the same in HBx-transfected and control cells), but rather to the caspase-dependent cleavage of PMCA, the ... demonstration that phorbol esters inhibited ER Ca2+ release [53], suggesting that PKCa is the isoform responsible for this effect As to the target, the demonstration of the phosphorylation of the ... tuning of ATP production to the increased needs of stimulated cells This could be demonstrated by the direct measurement of mitochondrial ATP levels with a targeted chimera of the ATP-sensitive...
- 10
- 469
- 0
Báo cáo khoa học: A functional polymorphism at the transcriptional initiation site in b2-glycoprotein I (apolipoprotein H) associated with reduced gene expression and lower plasma levels of b2-glycoprotein I docx
... Our novel data demonstrate that the )1CfiA mutation at the transcriptional initiation site is causative, which regulates b2GPI gene expression at the transcriptional level that ultimately affects ... with the )1CfiA mutation Alternatively, other genetic or nongenetic factors modulate the effect of the )1CfiA mutation on b2GPI plasma levels We also found that the )1CfiA mutation cannot explain the ... the )1CfiA mutation on reporter gene expression To further confirm that the )1CfiA mutation is associated with low expression of the b2GPI gene, we performed Fig Effect of the -1CÔA mutation on reporter...
- 9
- 462
- 0
Báo cáo Y học: Proliferating cell nuclear antigen from a basidiomycete, Coprinus cinereus Alternative truncation and expression at meiosis pptx
... contain some somatic cells, it was possible that all or some of the CoPCNAs were present in the somatic cells Therefore, to con®rm that all of the CoPCNAs came from the meiotic cells, the in distributions ... which the genomic DNA replicates, at leptotene at which the axial core in each of the chromosomes is formed, at zygotene at which the homologous chromosomes pair, and at pachytene at which the ... another mechanism, because the truncation occurred in the exon that has no intron Therefore, we called it Ôalternative truncationÕ in the later part of this report We searched for and found the...
- 11
- 325
- 0
Báo cáo hóa học: "Programmed cell death-1 (PD-1) at the heart of heterologous prime-boost vaccines and regulation of CD8+ T cell immunity" doc
... activated, effector and memory cells Figure Another dimension to the immune regulation of CD8+ T cells based on PD-1 expression The lack of PD-1 up-regulation during priming may define a separate ... to negative regulatory mechanisms that would otherwise impose restrictions on the expansion and activity of this key subset of T cells? To test our hypothesis, we compared the global gene expression ... of T cells Antigen stimulation + anti-PD-1 Ab FACS analysis (proliferation) PD-1 blockade restores the proliferation of PD-1hi CD8+ T cells Source of CD8+ T cells (Immunization) Proliferation...
- 11
- 505
- 0
Báo cáo hóa học: " Research Article Transmit Diversity at the Cell Border Using Smart Base Stations" ppt
... the power from the desired base station and the other base station This ratio also indicates where the mobile user is in respect to the base stations For C/I = dB the MT is directly between the ... modification as in the intercellular interfering case [22] Therefore, the transmit diversity techniques require no knowledge about the intercellular interference at the MT By using C-CDD or CAT the ... In the following, we separate the simulation results in three blocks First, we discuss the performances of CDD; then, the simulation results of CAT are debated; and finally, the influence of the...
- 11
- 286
- 0
Báo cáo sinh học: "At the crossroads: AMP-activated kinase and the LKB1 tumor suppressor link cell proliferation to metabolic regulation" pdf
... evidence that attests to the physiologic relevance of LKB1 to AMPK regulation Thus, HeLa cells not naturally express LKB1; in these cells, the drugs AICAR and phenformin fail to activate AMPK, ... Characterization of the AMP-activated protein kinase kinase from rat liver, and identification of threonine-172 as the major site at which it phosphorylates and activates AMP-activated protein ... AMPK-activating drugs could prove promising in the treatment of LKB1-deficient cancers Furthermore LKB1 now joins AMPK as an attractive target for activating drugs that would be useful in the treatment...
- 4
- 247
- 0
Báo cáo toán học: "Iodine Alters Gene Expression in the MCF7 Breast Cancer Cell Line: Evidence for an Anti-Estrogen Effect of Iodine" doc
... Symporter (NIS) in the thyroid, data suggests that iodine uptake in the breast may be NIS-independent, possibly through a facilitated diffusion system [12] Together this data indicates that the effect ... prior to iodine treatment Our data in figure shows that at 48 hours, mM iodine/iodide had no effect on cell proliferation or viability, relative to control cells However, treatment with mM iodine/iodide ... decrease in proliferation and viability was observed in the mM iodine/iodide condition Relative change in cell proliferation (A) and relative change in viability (B) for the control condition was set...
- 8
- 290
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25