return the visible state of a sprite 12

The welfare state as a determinant of women’s health: support for women’s quality of life in Canada and four comparison nations pptx

The welfare state as a determinant of women’s health: support for women’s quality of life in Canada and four comparison nations pptx

Ngày tải lên : 22/03/2014, 11:20
... 2000 from Statistics Canada (Statistics Canada, 2002) The data and analysis related to the availability and quality of childcare for Canadian women and those from the four comparisons nations comes ... Canada and four comparison nations, 2001 Canada Overall rank Seats in parliament (%) Female legislators, senior of cials, managers (%) Female professional and technical workers (%) Ratio female:male ... inequality and poverty Ottawa: Status of Women Canada; 2001 [5] Day S, Brodsky G Women and the equality deficit: the impact of restructuring Canada’s social programs Ottawa: Status of Women Canada; 1998...
  • 17
  • 843
  • 0
Báo cáo y học: " Binding of long-chain α-neurotoxin would stabilize the resting state of nAChR: A comparative study with α-conotoxin" docx

Báo cáo y học: " Binding of long-chain α-neurotoxin would stabilize the resting state of nAChR: A comparative study with α-conotoxin" docx

Ngày tải lên : 13/08/2014, 16:21
... His10 and Arg9 in 1XGA relative to the alpha and gamma subunits (A) before and (B) after MD simulations Position of residues His10 and Arg9 in 1XGA relative to the alpha and gamma subunits (A) before ... Mutational analysis has already revealed that the positive charge of His10 is not essential while that of Arg9 is essential; the side chains of Arg9 and His10 project prominently away from the ... molecular dynamics simulation without the ligand (apo form) and in the presence of each of the two antagonists The major goal was to observe and compare the conformational changes in the LBD in the presence...
  • 15
  • 161
  • 0
The Marketing Strategy of a multinational join stock company.doc

The Marketing Strategy of a multinational join stock company.doc

Ngày tải lên : 27/10/2012, 16:51
... another main task of the department • Financial and Accounting department: this department deals with all financial and accounting matters Another main function is to manage the use of capital ... 5D The Marketing Strategy of a multinational join stock company if they take care of their customers, market share and profits will follow Creating customer values and satisfaction is at the ... company and distribution of ideas, goods, and services to create exchanges that satisfy individual and organizational goals”2 The writer of the book The Silk Road to International Marketing” had...
  • 25
  • 623
  • 8
Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx

Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx

Ngày tải lên : 24/12/2013, 01:17
... made in the child DataTable This is the default None Indicates that no action takes place SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the ... you change the DataColumn in the parent DataTable on which the ForeignKeyConstraint was created, then the same change is also made in any corresponding DataRow objects in the child DataTable You ... of this type are shown in Table 12. 4 Table 12. 4: Rule ENUMERATION MEMBERS CONSTANT DESCRIPTION Cascade Indicates that the delete or update to the DataRow objects in the parent DataTable are also...
  • 6
  • 428
  • 0
The 2011 State of Inbound Marketing

The 2011 State of Inbound Marketing

Ngày tải lên : 09/02/2014, 20:56
... report is based on a January 2011 survey of 644 professionals familiar with their business‘ marketing strategy.1 The key takeaways are:      Inbound marketing channels are maintaining their low-cost ... 2009, inbound marketing had a 9% greater share of the lead generation budget; in 2011 its share was 17% greater Blogs and social media channels are generating real customers: 57% of companies using ... having costs lower than outbound channels PPC was the only inbound channel that was ranked among the outbound channels    Blogs, social media and organic search maintained the top slots as...
  • 19
  • 311
  • 0
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc

Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc

Ngày tải lên : 19/02/2014, 16:20
... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... corresponding to the cofactor-binding domain, or A R197 K128 K128 B AthalianaB 119 PativumB 119 SoleraceaB 119 NtabacumB 119 A. thalianaA 119 PsativumA 120 SoleraceaA 119 Chlamy 121 Synechocystis ... T T T T T G G G G G G G G G G A A A A A A A A A A A A A A A A A A A A K K K K K K K K K K A A A A A A A A A A V V V V V V V V V V S S S S A A A S A A L L L L L L L L L L V V V V V V V V V V L...
  • 8
  • 494
  • 0
Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx

Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx

Ngày tải lên : 19/02/2014, 19:20
... Proceedings of Fifth Annual Meeting of the North American Chapter of the Association for Computational Linguistics Ravi Sinha and Rada Mihalcea 2007 Unsupervised graph-based word sense disambiguation ... disambiguation In the 12th Conference of the European Chapter of the ACL Satanjeev Banerjee and Ted Pedersen 2003 Extended gloss overlaps as a measure of semantic relatedness In Proceedings of the ... Empirical Methods in Natural Language Processing Weiwei Guo and Mona Diab 2 012 Modeling sentences in the latent space In Proceedings of the 50th Annual Meeting of the Association for Computational...
  • 5
  • 585
  • 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

Ngày tải lên : 21/02/2014, 01:21
... together with oligonucleotides ECF-Q69G d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) ... prosthetic metal Arch Biochem Biophys 313, 296–303 Yamakura, F., Rardin, R.L., Petsko, G .A. , Ringe, D., Hiraoka, B.Y., Nakayama, K., Fujimura, T., Taka, H & Murayama, K (1998) Inactivation and ... addition of a second glutamine to the active site location of the iron enzyme (Fe [A1 41Q]) has a very similar effect to removal of the existing glutamine and SOD activities are reasonably similar between...
  • 12
  • 740
  • 0
The 2011 State of Inbound Marketing docx

The 2011 State of Inbound Marketing docx

Ngày tải lên : 06/03/2014, 21:20
... report is based on a January 2011 survey of 644 professionals familiar with their business‘ marketing strategy.1 The key takeaways are:      Inbound marketing channels are maintaining their low-cost ... 2009, inbound marketing had a 9% greater share of the lead generation budget; in 2011 its share was 17% greater Blogs and social media channels are generating real customers: 57% of companies using ... having costs lower than outbound channels PPC was the only inbound channel that was ranked among the outbound channels    Blogs, social media and organic search maintained the top slots as...
  • 19
  • 305
  • 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx

Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx

Ngày tải lên : 07/03/2014, 14:20
... functionality of such a triad is affected by the surrounding residues The results so far indicate that larger parts of the polar core of the catalytic TIM barrel of family 18 chitinases play a role ... mutant retains considerable activity, whereas the D14 2A mutant does not It has been shown by X-ray crystallography that replacement of the Asp142 analogue by alanine in other family 18 chitinases ... environmental factors that are taken into account in the calculations (background charges, desolvation penalty and the interaction with other titratable residues), the first factor was found to be the major...
  • 10
  • 651
  • 0
Báo cáo khoa học: Modulation of nitric oxide-mediated metal release from metallothionein by the redox state of glutathione in vitro doc

Báo cáo khoa học: Modulation of nitric oxide-mediated metal release from metallothionein by the redox state of glutathione in vitro doc

Ngày tải lên : 07/03/2014, 15:20
... the solutions until the start of the data acquisition While with the CD measurements nothing can be said about the faith of zinc bound in Cd5Zn2-MT2 after the addition of NO, the amount of cadmium ... Fig 1A The Cd-S charge transfer band at 260 nm is reduced clearly after the addition of NO, indicating the breaking of cadmium-cysteine bonds and therefore release of cadmium The presence of GSH ... behavior to the unpurified commercially available product All other chemicals were purchased from Sigma (Vienna, Austria) at the highest purity available Due to problems associated with the use of...
  • 9
  • 398
  • 0
Báo cáo khoa học: Spectroscopic and kinetic properties of the horseradish peroxidase mutant T171S Evidence for selective effects on the reduced state of the enzyme potx

Báo cáo khoa học: Spectroscopic and kinetic properties of the horseradish peroxidase mutant T171S Evidence for selective effects on the reduced state of the enzyme potx

Ngày tải lên : 07/03/2014, 21:20
... binding of His42 to the haem iron, i.e a major collapse or rearrangement of the distal cavity has taken place Hence, the overall conclusion that may be drawn is that modication of the proximal cavity ... mutation was obtained from comparison of the electronic absorption and RR spectra of the wild type and Thr171Ser either in the presence of the aromatic donor BHA or at alkaline pH Addition of saturating ... protein Mutations of distal residues can give rise to a substantial reduction of the catalytic activity if they have a direct impact on the disposition of the catalytically important His42 and Arg38...
  • 8
  • 542
  • 0
Báo cáo khoa học: "Techniques to incorporate the benefits of a Hierarchy in a modified hidden Markov model" pptx

Báo cáo khoa học: "Techniques to incorporate the benefits of a Hierarchy in a modified hidden Markov model" pptx

Ngày tải lên : 08/03/2014, 02:21
... when a final state is entered The difference between a standard HMM and a hierarchical HMM is that individual states in the hierarchical model can traverse to a sequence of production states, ... from state sin di(i) ¯(i) rectly to state sout , Astay,stay is the sum of all the internal transition probabilities within ¯(i) state Si , and Astay,out is the sum of all exit state probabilities ... parent state P ∗ moving it to the same level as state N ∗ , where the states of P ∗ and N ∗ now share the same parent, state S (9) where x and y are words adjacent to each other in the training...
  • 8
  • 528
  • 0
Báo cáo Y học: Subsite mapping of the binding region of a-amylases with a computer program ppt

Báo cáo Y học: Subsite mapping of the binding region of a-amylases with a computer program ppt

Ngày tải lên : 08/03/2014, 09:20
... SUMA software: subsite mapping of amylases This software calculates the apparent binding energies on the basis of the measured bond cleavage frequencies The calculations are based on the equation: ... been made to use this program for subsite mapping of other a- amylases found in the literature Evaluations of subsite maps of rice and barley a- amylases are thus also presented MATERIALS AND METHODS ... can vary according to the calculations The primary calculated subsite energy values can be refined to the best agreement of the measured and recalculated BCF data by the iteration Fig shows the...
  • 6
  • 387
  • 0
Báo cáo Y học: Crystal structure of the catalytic domain of a human thioredoxin-like protein pdf

Báo cáo Y học: Crystal structure of the catalytic domain of a human thioredoxin-like protein pdf

Ngày tải lên : 08/03/2014, 22:20
... Murakawa, M., Takahashi, S., Tsubuki, S., Kawashima, S., Sakamaki, K & Yonehara, S (1998) Purification, molecular cloning, and characterization of TRP32, a novel thioredoxin-related mammalian ... hTRXL-N may account for the formation of a monomer, instead of a dimer in the case of TRX Furthermore, the loss of intermolecular disulfide-bonds and the disbandment of the hydrophobic patch may also ... 1ERT) as a search model, then refined smoothly in alternating steps of automatic adjustment with CNS and manual adjustment with the program O [34] The final model has a final R-factor of 0.222 with a...
  • 9
  • 533
  • 0
Báo cáo Y học: Kinetic and biochemical analyses on the reaction mechanism of a bacterial ATP-citrate lyase ppt

Báo cáo Y học: Kinetic and biochemical analyses on the reaction mechanism of a bacterial ATP-citrate lyase ppt

Ngày tải lên : 08/03/2014, 22:20
... phosphorylation of the a subunit Another function of AclB was found to be stabilization of the enzyme, as AclB prevented the degradation of AclA that was otherwise observed in the absence of AclB After ... into account the reaction mechanism of mammalian ACL [23], the nal step of the reaction can be assumed to be the nucleophilic attack of CoA to the phosphorylated carbonyl carbon of citryl phosphate, ... dissociation (AB) are shown in lanes and 4, the individual AclA subunits (a) are shown in lanes and 5, and AclB subunits (b) in lanes and Molecular masses (kDa) are indicated on the side of each panel The...
  • 8
  • 551
  • 0
Báo cáo " Influence of laser parameters on the stationary operation of a two-mode random micro laser " pdf

Báo cáo " Influence of laser parameters on the stationary operation of a two-mode random micro laser " pdf

Ngày tải lên : 14/03/2014, 13:20
... densities, we vary one of parameters in table and remain invariable all the rest of parameters The obtained results are shown in Section 3 Influences of laser parameters on saturated photon densities ... Mathematics - Physics 23 (2007) 139-142 Discussion and conclusion In the stationary operation of two-mode random microlaser, the variation of laser parameters influences clearly on the transformation ... increase of one mode photon density caused in the decrease of the other one Fig 1a Gain coefficient α1 varies Fig 1b Gain coefficient α2 varies D.V Hoang, M.H Hanh / VNU Journal of Science, Mathematics...
  • 4
  • 343
  • 0
Đề tài " On the Julia set of a typical quadratic polynomial with a Siegel disk " ppt

Đề tài " On the Julia set of a typical quadratic polynomial with a Siegel disk " ppt

Ngày tải lên : 14/03/2014, 22:20
... S1 at Lemma 4.10 There exist the following asymptotically universal bounds: n area(P0 An+2 ) n area(P0 n area(Pqn+1 An+2 ) n area(Pqn+1 area(Qn An+2 ) area(Qn An+2 ) An+2 ) An+2 ) n n area(P0 ... neighborhood of U {x(U )}, where x(U ) is the root of U The boundary of each puzzle piece P consists of a rectifiable arc in A( ∞) and a rectifiable arc in J(F ) The latter arc starts at an iterated preimage ... Finally, it returns along the boundaries of another chain of descendants of U until it reaches a different iterated preimage of β We call I = I(P ) ⊂ ∂U the base arc of the puzzle piece P 19 QUADRATIC...
  • 53
  • 383
  • 0