response of the voltage on part of the mixed conductor to a step change in the applied voltage

Báo cáo lâm nghiệp: "Autophagic response of higher plant cells to a prolonged period of sucrose deprivation" docx

Báo cáo lâm nghiệp: "Autophagic response of higher plant cells to a prolonged period of sucrose deprivation" docx

Ngày tải lên : 09/08/2014, 04:20
... progressively in the same ratio as the decrease in intracellular cardiolipin or cytochrome aa In addition, it was esta3 blished that: ) on a protein basis, the rate of uptake in state was about the same for ... levels of these specific mitochondrial markers during sucrose starvation Quantitative determination of cytochrome aa and cardiolipin in sycamore cell mitochondria The values for cytochrome aa cardio3 ... in plastids (not shown), whereas the increase in total cell fatty acids was attributable to the synthesis of new cytoplasmic material, such as mitochondria Of particular interest was the marked...
  • 10
  • 182
  • 0
Báo cáo Y học: Human bile salt-stimulated lipase has a high frequency of size variation due to a hypervariable region in exon 11 pot

Báo cáo Y học: Human bile salt-stimulated lipase has a high frequency of size variation due to a hypervariable region in exon 11 pot

Ngày tải lên : 24/03/2014, 03:21
... samples The fragment that was sequenced from mother D1 was shown to carry a 98-bp deletion that changes the reading frame of the gene and predicts a premature translational stop after 632 amino acids ... most common variant An onco-fetal variant of BSSL, denoted feto-acinar pancreatic protein (FAPP), has been detected in human embryonic and fetal pancreas and in pancreatic tumoral cell lines [35,36] ... common 120-kDa variant together with one of lower mass, carried the deletion in one of the alleles, whereas the mother with only the low molecular mass variant in milk (D2) carried deletions in...
  • 9
  • 520
  • 0
Báo cáo y học: "Shared expression of phenotypic markers in systemic sclerosis indicates a convergence of pericytes and fibroblasts to a myofibroblast lineage in fibrosis" pdf

Báo cáo y học: "Shared expression of phenotypic markers in systemic sclerosis indicates a convergence of pericytes and fibroblasts to a myofibroblast lineage in fibrosis" pdf

Ngày tải lên : 09/08/2014, 07:20
... KH carried out the nailfold capillaroscopy analysis KC provided antisera and participated in drafting the manuscript CPD provided the clinical data and analysis CMB participated in drafting the ... immunostaining for PCNA was seen in interstitial fibroblastic cells or microvessels Analysis of the dcSSc samples revealed a marked expansion of PCNA immunostaining in two cases PCNA staining was ... evidence of proliferation in dcSSc skin In order to determine whether the appearance of myofibroblasts was accompanied by cell proliferation, we used an antibody against PCNA to analyse the distribution...
  • 11
  • 397
  • 0
Tài liệu Temi di discussione: Are there asymmetries in the response of bank interest rates to monetary shocks? pdf

Tài liệu Temi di discussione: Are there asymmetries in the response of bank interest rates to monetary shocks? pdf

Ngày tải lên : 17/02/2014, 03:20
... this paper are those of the authors only and in no way involve the responsibility of the Bank of Italy Email: leonardo.gambacorta@bancaditalia.it; simonetta.iannotti@bancaditalia.it Among cross-country ... the enactment of the 1993 Consolidated Law on Banking which has fostered competition in the banking sector One of the aims of this paper is to examine whether the increased competition has had ... ARE THERE ASYMMETRIES IN THE RESPONSE OF BANK INTEREST RATES TO MONETARY SHOCKS? by Leonardo Gambacorta* and Simonetta Iannotti** Abstract This paper examines the velocity and asymmetry of the...
  • 37
  • 463
  • 0
báo cáo hóa học:" The effect of peer-led education on the life quality of mastectomy patients referred to breast cancer-clinics in Shiraz, Iran 2009" pot

báo cáo hóa học:" The effect of peer-led education on the life quality of mastectomy patients referred to breast cancer-clinics in Shiraz, Iran 2009" pot

Ngày tải lên : 20/06/2014, 16:20
... self care, relaxation techniques and adaptation to the illness The training was performed in sessions and each session lasted for one hour The training sessions for peer educators were conducted ... improved quality of life as women need to depend on a source in relation to breast cancer So assistance in various phases needs to be taken into account in an effort to evaluate the “navigator role” ... function and reduce symptoms in their arm and breast as well as participate in the educational Page of sessions Therefore it seems that participating in physiotherapy sessions alongside peer support...
  • 7
  • 367
  • 0
Báo cáo y học: "The contact-mediated response of peripheral-blood monocytes to preactivated T cells is suppressed by serum factors in rheumatoid arthritis" ppt

Báo cáo y học: "The contact-mediated response of peripheral-blood monocytes to preactivated T cells is suppressed by serum factors in rheumatoid arthritis" ppt

Ngày tải lên : 09/08/2014, 07:20
... contributions MR was responsible for most of the experiments and data analysis as well as drafting the manuscript SK and RS participated in the collection of the samples and in the interpretation of the ... supervised the collection of the samples as well as the design of the study SH participated in the design of the study and in its coordination, and participated in the interpretation of the results ... designed the study, participated in its coordination, participated in the interpretation of the results, and drafted the manuscript All authors read and approved the final manuscript Acknowledgements...
  • 11
  • 518
  • 0
báo cáo khoa học:" The effect of peer-led education on the life quality of mastectomy patients referred to breast cancer-clinics in Shiraz, Iran 2009" pot

báo cáo khoa học:" The effect of peer-led education on the life quality of mastectomy patients referred to breast cancer-clinics in Shiraz, Iran 2009" pot

Ngày tải lên : 12/08/2014, 01:21
... self care, relaxation techniques and adaptation to the illness The training was performed in sessions and each session lasted for one hour The training sessions for peer educators were conducted ... improved quality of life as women need to depend on a source in relation to breast cancer So assistance in various phases needs to be taken into account in an effort to evaluate the “navigator role” ... function and reduce symptoms in their arm and breast as well as participate in the educational Page of sessions Therefore it seems that participating in physiotherapy sessions alongside peer support...
  • 7
  • 385
  • 0
Báo cáo y học: "Impact of the introduction of new vaccines and vaccine wastage rate on the cost-effectiveness of routine EPI: lessons from a descriptive study in a Cameroonian health district" potx

Báo cáo y học: "Impact of the introduction of new vaccines and vaccine wastage rate on the cost-effectiveness of routine EPI: lessons from a descriptive study in a Cameroonian health district" potx

Ngày tải lên : 13/08/2014, 11:22
... vaccination sessions, transportation of vaccines, reporting (immunization and disease surveillance), coordination meetings, supervision, and cold chain temperature monitoring and maintenance ... on the basis of administrative target populations, coverage objectives, wastage norms and a security margin In a context of high population mobility, the target population is hard to master and ... vaccine wastage in excess of the national norm drastically increases the risk of vaccine stock-outs This study aimed to assess the impact of the introduction of 2-dose lyophilized DPT-HB-Hib and...
  • 8
  • 302
  • 0
Báo cáo y học: "PI3K signaling and miRNA expression during the response of quiescent human fibroblasts to distinct proliferative stimuli" pdf

Báo cáo y học: "PI3K signaling and miRNA expression during the response of quiescent human fibroblasts to distinct proliferative stimuli" pdf

Ngày tải lên : 14/08/2014, 16:21
... microarray data analysis Microarray images were quantified using GenePix 4.0 software (Axon) Data were uploaded to the Longhorn Array Database as well as the Acuity 4.0 database (Axon) Array normalization ... as at the authors laboratory web site [14], and the ratio data tables for all gene sets described here are available as accompanying Additional data files A small subset of the expression changes ... purification using the RNeasy Mini kit (Qiagen, Hilden, Germany) according to manufacturer's instructions microRNA preparation Total RNA was isolated using either the mirVana miRNA Isolation Kit (Ambion)...
  • 15
  • 257
  • 0
SIGNALING MECHANISMS THAT SUPPRESS THE ANABOLIC RESPONSE OF OSTEOBLASTS AND OSTEOCYTES TO FLUID SHEAR STRESS

SIGNALING MECHANISMS THAT SUPPRESS THE ANABOLIC RESPONSE OF OSTEOBLASTS AND OSTEOCYTES TO FLUID SHEAR STRESS

Ngày tải lên : 24/08/2014, 11:45
... mechanosomes Src kinase is involved in a number of signaling pathways that respond to changes in external loads on bone An inhibition of Src causes an increase in the expression of the anabolic ... activation of the prosurvival protein Akt was increased in response to fluid shear stress Next, Akt inactivates proteases that initiate the apoptotic pathway In addition, Akt phosphorylates the inhibitor ... gain an appreciation for always considering the impact of research in a greater context Thank you for always being a source of guidance and encouragement during my graduate training     I also...
  • 134
  • 134
  • 0
Household Composition and the Response of Child Labor Supply to Product Market Integration: Evidence from Vietnam

Household Composition and the Response of Child Labor Supply to Product Market Integration: Evidence from Vietnam

Ngày tải lên : 25/04/2016, 08:10
... welfare Generally speaking, there appears to be strong evidence that there are large gains from trade to be had by national and international market integration and that these gains from trade in ... all of the variation in rice prices observed in the data is attributable to national and international product market integration However, to the extent that market integration leads to relative ... as well as none of them Three constructed variables in the top panel of table measure child participation in a combination of these activities Market work indicates participation in wage work...
  • 54
  • 289
  • 0
Báo cáo khoa học: Death inducer obliterator protein 1 in the context of DNA regulation Sequence analyses of distant homologues point to a novel functional role docx

Báo cáo khoa học: Death inducer obliterator protein 1 in the context of DNA regulation Sequence analyses of distant homologues point to a novel functional role docx

Ngày tải lên : 07/03/2014, 21:20
... maintain transcription The PHF3 protein was recovered in initial analyses and also contains a TFS2M domain showing the same architecture as the DIDO1 long isoform, although lacking the dPHD The ... strongly suggest that DIDO-related apoptosis occurs as a result of alterations in DNA regulation caused by chromatin instability Computational analyses Although all splice variants share common ... that the retrieved proteins all appear to have a role in DNA regulation, in the context of chromatin stability, and to form part of higher complexes linked to active chromatin The DIDO1 gene has...
  • 7
  • 658
  • 0
Báo cáo khoa học: "The Benefit of Stochastic PP Attachment to a Rule-Based Parser" doc

Báo cáo khoa học: "The Benefit of Stochastic PP Attachment to a Rule-Based Parser" doc

Ngày tải lên : 17/03/2014, 04:20
... rather than remain undecided, on the reasonable assumption that it will lead to more correct than wrong decisions Note that the same reasoning applies to many of the violable constraints in a ... no additional advantage In any case, the exact figure depends closely on the valuation of the existing constraints of the grammar and is of little importance as such 227 Label PP ADV OBJA APP ... General category constraints ensure that the preposition can attach to nouns and verbs, but not, say, to a determiner or to punctuation • A weak constraint on adjuncts says that adjuncts are usually...
  • 8
  • 331
  • 0
Gradual phase and morphology transformation of Fe3O4nanoparticles to a - FeOOH nanorods in alcohol/water mediain the presence of surfactant F127

Gradual phase and morphology transformation of Fe3O4nanoparticles to a - FeOOH nanorods in alcohol/water mediain the presence of surfactant F127

Ngày tải lên : 19/03/2014, 16:48
... nanorods are a- FeOOH The gradual phase transformation from Fe3O4 to a- FeOOH with increasing volume ratios of alcohol/water is consistent with XRD results well The magnetism of the samples prepared in ... in pure water and in alcohol/water media is also investigated, as shown in Fig The value of saturation magnetization of samples a, b, and c is 75.4 emu/g (Fig 3a) , 39.2 emu/g (Fig 3b), and (Fig ... with 52% of Fe3O4 in mass and 48% of a- FeOOH in mass Results and discussion Figure shows XRD patterns of the samples prepared in pure water and in alcohol/water media XRD pattern of Fig 1a matches...
  • 4
  • 658
  • 0
Báo cáo khóa học: Modulation of activity of NADH oxidase from Thermus thermophilus through change in flexibility in the enzyme active site induced by Hofmeister series anions ppt

Báo cáo khóa học: Modulation of activity of NADH oxidase from Thermus thermophilus through change in flexibility in the enzyme active site induced by Hofmeister series anions ppt

Ngày tải lên : 30/03/2014, 13:20
... donor/substrate and the acceptor/avin cofactor in the hydride transfer and/or other side chains with an active role in the catalytic site of NADH oxidase Modulation of the conformational dynamics by the ... in the presence of perchlorate anions, i.e a decrease in the asymmetry of the tryptophan residue and/or the avin cofactor in the active site, may result from dissociation of the avin cofactor in ... localization of Trp47 and the avin cofactor causes resonance energy transfer, resulting in partial quenching of the tryptophan uorescence; therefore, dissociation of the avin would be accompanied...
  • 10
  • 316
  • 0
Báo cáo sinh học: " Open Access Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" docx

Báo cáo sinh học: " Open Access Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" docx

Ngày tải lên : 18/06/2014, 18:20
... TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG Consensus (1851) TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG ... cloned DNA fragments, an MDCK-based assay for replication of an artificial influenza vRNA containing a reporter gene was developed based on an analogous assay used to evaluate the human RNA pol ... strains are ca A/ Ann Arbor/6/60 Chicken Xenopus Rat TATTGGACCTGGAGATAGGTACTGACACGC Mouse TTTGGGCCGCCGGGTTATATGCTGACACGC 216 bases TGCCTTATATGTTCGTCTGTAGGAGCGAGT GCATGTGCGGGCAGGAAGGTAGGGGAAGAC GATC...
  • 12
  • 567
  • 0
Báo cáo hóa học: " Validity and reliability of the Spanish version of the DN4 (Douleur Neuropathique 4 questions) questionnaire for differential diagnosis of pain syndromes associated to a neuropathic or somatic component" docx

Báo cáo hóa học: " Validity and reliability of the Spanish version of the DN4 (Douleur Neuropathique 4 questions) questionnaire for differential diagnosis of pain syndromes associated to a neuropathic or somatic component" docx

Ngày tải lên : 18/06/2014, 22:20
... diagnosis of neuropathic pain is a total score of 4/10 All questions are related to pain which is the claim for current medical consultation Translation of the questionnaire The adaptation into ... logistic and evaluation of data All authors read and approved the final manuscript Additional material Additional file Cuestionario DN4 This appendix includes the Spanish version of DN4 questionnaire ... and its association to abnormal sensations (tingling, pins and needles, numbness, itching) The other items are related to neurological examination in the painful area (touch hypoesthesia, pinprick...
  • 10
  • 532
  • 0
Báo cáo hóa học: " Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" pdf

Báo cáo hóa học: " Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" pdf

Ngày tải lên : 20/06/2014, 01:20
... TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG Consensus (1851) TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG ... cloned DNA fragments, an MDCK-based assay for replication of an artificial influenza vRNA containing a reporter gene was developed based on an analogous assay used to evaluate the human RNA pol ... strains are ca A/ Ann Arbor/6/60 Chicken Xenopus Rat TATTGGACCTGGAGATAGGTACTGACACGC Mouse TTTGGGCCGCCGGGTTATATGCTGACACGC 216 bases TGCCTTATATGTTCGTCTGTAGGAGCGAGT GCATGTGCGGGCAGGAAGGTAGGGGAAGAC GATC...
  • 12
  • 627
  • 0
báo cáo hóa học:" Validity and reliability of the Spanish version of the DN4 (Douleur Neuropathique 4 questions) questionnaire for differential diagnosis of pain syndromes associated to a neuropathic or somatic component" pdf

báo cáo hóa học:" Validity and reliability of the Spanish version of the DN4 (Douleur Neuropathique 4 questions) questionnaire for differential diagnosis of pain syndromes associated to a neuropathic or somatic component" pdf

Ngày tải lên : 20/06/2014, 16:20
... diagnosis of neuropathic pain is a total score of 4/10 All questions are related to pain which is the claim for current medical consultation Translation of the questionnaire The adaptation into ... logistic and evaluation of data All authors read and approved the final manuscript Additional material Additional file Cuestionario DN4 This appendix includes the Spanish version of DN4 questionnaire ... and its association to abnormal sensations (tingling, pins and needles, numbness, itching) The other items are related to neurological examination in the painful area (touch hypoesthesia, pinprick...
  • 10
  • 489
  • 0
báo cáo hóa học: " Evaluation of 18F-nifene binding to a4b2 nicotinic receptors in the rat brain using microPET imaging" ppt

báo cáo hóa học: " Evaluation of 18F-nifene binding to a4b2 nicotinic receptors in the rat brain using microPET imaging" ppt

Ngày tải lên : 21/06/2014, 02:20
... sterile saline to a final volume of 0.3 mL The dose was injected intravenously into the tail vein of the rat Isoflurane was reduced and maintained at 2.5% following the injection The scans were carried ... study, rats were anesthetized using 4.0% isoflurane The rat was then positioned on the scanner bed by placing it on a warm water circulating heating pad, and anesthesia was applied using a nose cone ... using a twodimensional Filter Back Projection using a Hanning Filter with a Nyquist cutoff at 0.5, and were corrected for attenuation using the Co-57 attenuation scan data A calibration was conducted...
  • 9
  • 392
  • 0