resonance a potential tool for brain perfusion imaging measurement of the xenon t1 in
Báo cáo y học: "Three-dimensional and thermal surface imaging produces reliable measures of joint shape and temperature: a potential tool for quantifying arthritis" pdf
Ngày tải lên :
09/08/2014, 10:22
... B, Akoka S, Avimadje AM, Garaud P, Naccache L, Le Pape A, Valat JP: Magnetic resonance imaging: a valuable method for the detection of synovial inflammation in rheumatoid arthritis J Rheumatol ... children 3D and thermal surface imaging can quantify clinically meaningful changes in arthritic joints in response to therapy To demonstrate the potential utility of 3D and thermal surface imaging to ... medial-lateral plane, cm in the proximal-distal plane, and cm in the vertical plane and MCP ROI box dimensions of 10 cm in the medial-lateral plane, cm in the proximal-distal plane, and cm in the...
- 9
- 344
- 0
báo cáo khoa học: "Atomic force microscopy: a powerful tool for high-resolution imaging of spermatozoa" ppt
Ngày tải lên :
11/08/2014, 00:22
... protein, are the major DNA-binding proteins in the nucleus of spermatozoa of most vertebrates and package the DNA in a volume less than 5% of a somatic cell nucleus The binding of protamine to ... functional competence of the spermatozoa The major advantage of AFM in pathological studies of spermatozoa is that it allows the evaluation of position and form of the acrosome Electron microscopy investigation ... spermatozoa AFM of AFM of normal human spermatozoa a 2D image (8.00 × 8.00 µm scan) of normal sperm head b Height profile of the head region of spermatozoa showing clear difference in the head and...
- 6
- 363
- 0
Tài liệu mẫu phân tích IPA Importance performance analysis as a strategic tool for destination attractiveness an analysis of domestic
Ngày tải lên :
01/08/2014, 10:25
... meeting locals and learning a local recipe These destination attraction attributes having low importance rating and a low performance rating suggest that investing resources to these areas may offer ... also institutions like the Vaastu Vidya Gurukulam, which gives training in vaastu shastra and a school for Mohiniattam dancer Further, the tourists can learn handicrafts, local cuisines, rural games ... performance of the destination can be directly compared for each attraction via the IPA plot (or grid) The mean values of importance and performance scores are then used as the crossing point in...
- 7
- 874
- 3
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf
Ngày tải lên :
18/02/2014, 13:20
... following primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢; Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; ... 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢ The PCR solution was prepared in the buffer ... pure In the lanes containing Ab(1–42) and Ab(M1– 42), there were prominent bands at approximately kDa and faint bands at approximately 14 kDa The band at approximately 14 kDa is not an impurity as...
- 16
- 691
- 0
ISO 4698 iron ore pellets for blast furnace feedstocks determination of the free swelling index
Ngày tải lên :
28/09/2016, 17:41
... Sampling, sample preparation and preparation of test portions Sampling and sample preparation Sampling of a lot and preparation of a test sample shall be in accordance with ISO 3082 The size range ... is the mass, in grams, of the test portion plus the cage in water in B.2.4.5; m2 is the mass, in grams, of the test portion in air in B.2.4.7; m3 is the mass, in grams, of the cage in water in ... system, capable of supplying the gases and regulating gas flow rates 6.6 Volumetric apparatus, capable of measuring the volume of the test portion to an accuracy of 0,2 mL Annex B shows examples of...
- 26
- 444
- 0
Báo cáo y học: "Protein C: a potential biomarker in severe sepsis and a possible tool for monitoring treatment with drotrecogin alfa (activated)" pptx
Ngày tải lên :
13/08/2014, 08:21
... evaluations In the PROWESS trial, plasma samples were obtained at baseline (day of randomization) and daily through to study day A central laboratory (Covance Central Laboratory Services, Indianapolis, ... Indianapolis, IN, USA) performed all assays The PC activity assay was performed on a STA® coagulation analyzer using the STA®-Staclot® Protein C kit (Diagnostica Stago, AsnieresSur-Seine, France), ... effect of DrotAA in patients at lower and higher risk for death, as defined by the statistically defined baseline cut-off for the 11 potential biomarkers shown in Table PC was the only biomarker at...
- 11
- 343
- 0
Báo cáo y học: "High-Resolution Flow Cytometry: a Suitable Tool for Monitoring Aneuploid Prostate Cancer Cells after TMZ and TMZ-BioShuttle Treatment"
Ngày tải lên :
26/10/2012, 09:48
... initiated and boosted by aberrant activation of cell cycle activating pathways but also by the inactivation of cell death associated signals resulting in the loss of the proliferation control and ... Due to the fact that prostate cancer is one of the leading causes of death in the industrialized world, the need of new approaches for control the CaP is the major goal in the current research ... radiation therapy Anti-angiogenesis strategies avoiding the disappointing results are discussed [39] The increasing understanding of molecular mechanisms and of the complex regulatory cellular...
- 10
- 408
- 0
Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"
Ngày tải lên :
31/10/2012, 14:59
... and RNA synthesis, and inosine that will be degraded into hypoxanthine and xanthine and finally into uric acid Hypoxanthine and guanine may enter in a salvage pathway, using hypoxanthine-guanine ... mg/kg for 3-5 days maintains the same efficacy [25] Anyway, we may have favourable issues by changing the dose of rasburicase, according to the various clinical states, the type of malignancy and ... hyperuricemic and in non-hyperuricemic patients These values were maintained during the course of treatment malized within days after the start of rasburicase Table Mechanism of action of allopurinol Table...
- 11
- 715
- 0
Tài liệu Commodity-Linked Bonds: A Potential Means for Less-Developed Countries to Raise Foreign Capital doc
Ngày tải lên :
16/02/2014, 02:20
... Atta-Mensah Monetary and Financial Analysis Department Bank of Canada Ottawa, Ontario, Canada K 1A 0G9 jattamensah@bankofcanada.ca The views expressed in this paper are those of the author No ... risk, the borrower could have an option to pay the minimum of the face value and the value of the reference amount of the commodity at the maturity date In that case, the terminal value of the ... Bank of Canada Working Papers Documents de travail de la Banque du Canada Working papers are generally published in the language of the author, with an abstract in both of cial languages Les...
- 43
- 870
- 0
Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt
Ngày tải lên :
19/02/2014, 05:20
... to the antigens laminin and myosin (data not shown) Further perturbation experiments were carried out using the protein lactoferrin Lactoferrin, an ironbinding protein of the transferrin family, ... washed, mounted and analyzed as described above To semipermeabilize cells for intracellular staining, cells were incubated in 4% paraformaldehyde for 30 at °C in the first instance and then stained ... nuclear protein consisting of a negatively charged N-terminal domain, an RNA-binding domain and a C-terminal domain rich in RGG motifs [54] Nucleolin has been reported to be involved in a diverse...
- 14
- 669
- 0
Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt
Ngày tải lên :
19/02/2014, 16:20
... Clarke [22], we linearize the system of Eqn (3) in the vicinity of the steady state We this to investigate the stability of this state In this way we obtain the in uence a small change in the ... negative when the substance on the right is a substrate of the reaction Then the arrow points backward, i.e away from the substance and there is a right-hand factor a equal to )1 In uences of the ... of paths through reaction-centered graphs of the type of Graph (these paths may contain parallel and antiparallel arrows) The sign of that element therefore depends on the both the sign and the...
- 11
- 638
- 0
A NEW TOOL FOR SCALING IMPACT: HOW SOCIAL IMPACT BONDS CAN MOBILIZE PRIVATE CAPITAL TO ADVANCE SOCIAL GOOD doc
Ngày tải lên :
06/03/2014, 08:20
... investing—has paved the way for the development of an innovative financial instrument: the Social Impact Bond A New Tool for Scaling Impact u The Promise and Challenges of Social Impact Bonds The Social ... interactions, and varying dimensions of risks, Social Impact Bonds represent a potentially valuable new tool for scaling social impact tRacy palandJian CEO, Social Finance, Inc A New Tool for Scaling ... Impact 21 sIBs sIgnIFY a neW PaRadIgM oF PuBlIcPRIvate PaRtneRsHIPs In tHe WaKe oF tHe FInancIal cRIsIs, one tHat PRIvatIzes tHe RIsKs and sHaRes tHe gaIns FInancIal RIsK As described above, investors...
- 36
- 262
- 0
Báo cáo khoa học: "A Debug Tool for Practical Grammar Development" doc
Ngày tải lên :
08/03/2014, 04:22
... grammar engineering for practical applications In Proc of the Workshop on Grammar Engineering and Evaluation, pages 15–21 Patrick Paroubek, Yves Schabes, and Aravind K Joshi 1992 XTAG – a graphical ... MEDLINE abstracts with tags based on a slightly modified version of GDADTD2 (Hasida, 2003) The corpus is “partially parsed”; the attachments of prepositional phrases are annotated manually The tags ... Processing Society of Japan SIG Notes NL-127, pages 173–178, September In Japanese Takashi Miyata, Kazuma Takaoka, and Yuji Matsumoto 1999 Implementation of GUI debugger for unification-based grammar...
- 4
- 360
- 0
Báo cáo khoa học: TICL – a web tool for network-based interpretation of compound lists inferred by high-throughput metabolomics doc
Ngày tải lên :
16/03/2014, 01:20
... metabolic pathways Most of the available tools aim to interpret the whole mass spectra rather than a sparse list of compounds differentially present between samples Other tools are available that ... 101–103 2094 A V Antonov et al 33 Okuda S, Yamada T, Hamajima M, Itoh M, Katayama T, Bork P, Goto S & Kanehisa M (2008) KEGG atlas mapping for global analysis of metabolic pathways Nucleic Acids Res ... of multiple reactant pairs, and the one that appears in a KEGG metabolic pathway is called a main pair To build a global reaction network, we used only compounds classified as main reaction pairs...
- 11
- 401
- 0
Báo cáo khoa học: "A Graphical Tool for GermaNet Development" ppt
Ngày tải lên :
17/03/2014, 00:20
... would mean that the wordnet data for a given language would have to be stored in a relational database and that the tool itself can handle the language specific data structures of the wordnet in question ... can have an associated example that indicates a possible usage of the lexical unit for that particular frame The tab Examples and Frames is thus particularly geared towards the editing of verb entries ... choosing the appropriate tab indicated at the bottom of Figure By clicking one of these tabs, the corresponding panel appears below these tabs In Figure the panel for Graph with Hyperonyms and...
- 6
- 349
- 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt
Ngày tải lên :
23/03/2014, 15:21
... proteins in the algae of red lineage which contain Haptophyta, diatoms and brown algae and are characterized by chlorophyll a ⁄ c The psbP gene is present in some of the algae in the red lineage ... behavior of this band in the diatom is thus similar to that of the PsbPlike protein in cyanobacteria [3,12] The fact that C gracilis, P gyrans, L japonica and U pinnatifida contained bands cross-reacted ... 1, a glaucophyte contained the cyanobacterial-type extrinsic proteins (PsbU and PsbV), and chlorophyll a ⁄ c-containing algae diatoms, haptophyte and brown algae such as retained the red algal-type...
- 11
- 501
- 0
Báo cáo khoa học: "a Visual Tool for Validating Sense Annotations" docx
Ngày tải lên :
31/03/2014, 01:20
... the validator, as explained hereafter Before starting the interface, the validator can also choose whether to add a virtual annotator aSSI to the set of annotators A This virtual annotator tags ... Experiments on the validation of sense annotations assisted by lexical chains In Proc of the European Chapter of the Annual Meeting of the Association for Computational Linguistics (EACL) Trento, Italy ... Conclusions In this paper we presented Valido, a tool for the validation of manual and automatic sense annotations Valido allows a validator to analyse the coherency of different sense annotations...
- 4
- 399
- 0
báo cáo hóa học: " A rehabilitation tool for functional balance using altered gravity and virtual reality" potx
Ngày tải lên :
19/06/2014, 10:20
... rehabilitation of strength and balance in a wide range of categories of patients The system allows natural mediolateral APAs to occur across a wide range of gravity-like loads, an important balance ... recognized is that the harness supporting the subject decreases the need for natural APAs that are required for independent gait The main site for an active control of balance during gait is the step-to-step ... surface and while balancing on the balance board G-load can be varied continuously and the Bambi compressor can provide airflow simultaneously to the air bearings and the pneumatic actuator The...
- 7
- 475
- 0
MATLAB – A FUNDAMENTAL TOOL FOR SCIENTIFIC COMPUTING AND ENGINEERING APPLICATIONS – VOLUME 1 ppt
Ngày tải lên :
29/06/2014, 09:20
... Diagnosis Using Matlab 69 Jacques Fanjason Ramahaleomiarantsoa, Eric Jean Roy Sambatra, Nicolas Hộraud and Jean Marie Razafimahenina Chapter Dynamic and Quasi-Static Simulation of a Novel Compliant MEMS ... or in the presence of faults This model provides the matrix data of the several characteristic quantities of the machine These data are included as input variables of the PCA method Then, the authors ... MATLAB/Simulink in order to analyze the dynamic and quasi-static behavior of the compliant MEMS amplifier Chapter proposes the SagWave software as a visual interactive capability to generated data for the...
- 534
- 691
- 0
MATLAB – A FUNDAMENTAL TOOL FOR SCIENTIFIC COMPUTING AND ENGINEERING APPLICATIONS – VOLUME 2 potx
Ngày tải lên :
29/06/2014, 09:20
... Prokop, Walid Hassairi, Moncef Bousselmi, Mohamed Abid, Carlos Valderrama, Moulay Tahar Lamchich, Nora Lachguer, Gaizka Almandoz, Gaizka Ugalde, Javier Poza, Ana Julia Escalada, Oriol Font-Bach, Antonio ... using the S-function of MATLAB/SIMULINK, as a practical tool for students in control engineering The MATLAB/SIMULINK to SystemC interface and the advanced version of transactors are combined in ... rooftop and multi-screen effects for increasing BS height over the rooftop of karama regular buildings 170 pathloss vs BS antenna height for Almajmoaa and karama regions karama district Almajmoaa...
- 324
- 788
- 0