repairing color with a good scan
Effect of tunneling current on the growth of silicon islands on si(111) surfaces with a scanning tunneling microscope
... currents above nA and at a tip bias voltage of −8 and −10 V, the growth of islands was unstable The late-stage growth rate was about three times lower than the early-stage growth rate, and was almost ... are indicated by arrows in (a) and (b), respectively Fig Island height as a function of the duration of bias voltage Islands were grown at a negative tip bias voltage of −10 V and at a constant ... been measured that the islands, grown with the STM, have a high aspect ratio (height divided by base length) of about 0.3 [7] We shall assume that all islands are cone-shaped with an aspect ratio...
- 7
- 434
- 0
Báo cáo hóa học: " Research Article Unsupervised Video Shot Detection Using Clustering Ensemble with a Color Global Scale-Invariant Feature Transform Descriptor" ppt
... which are treated as gray-level values in grayscale images for feature extraction We adopt a very powerful color quantization method called Fibonacci lattice-quantization [25] to quantize color ... Features extracted by SIFT are invariant to image scale, rotation, and changing viewpoints The algorithm transforms a grayscale image into scale-invariant coordinates of local features, which are the ... and random data splits Fred and Jain [18], based on the idea of evidence accumulation, considered that each partition is viewed as an independent evidence of data organization Individual data...
- 10
- 283
- 0
ARBITRATION – A GOOD CHOICE FOR DISPUTES WITH ECONOMIC AND COMMERCIAL NATURE
... Kennen, Advantages and Disadvantages of ADR - Understanding Alternative Dispute Resolution (2008), available at http://www.suite101.com/content/advantages-and- disadvantages-of-adr -a5 8925 Garry ... enforcement of an international arbitral award is far easier and more certain than that of a foreign court judgment41 In brief, arbitration guarantees its parties to reach a final and binding award, which ... neutral and adjustable to be more appropriate for each kind of dispute Those advantages can hardly found in litigation at court ENFORCEMENT OF ARBITRAL AWARD Another significant advantage of arbitration...
- 15
- 1,456
- 1
Báo cáo nghiên cứu khoa học: " BUILDING A GOOD IMAGE FROM TWO COLOR IMAGES OF CAMERA MODEL USING GA AND DISCRETE WAVELET TRANSFORM" pptx
... perform the analysis and synthesis on each color separately to build a good color image Fig and are two red color images perceived from two original color image 4a and 4b After passing these images ... Histogram and standard deviation comparisons (a) , (c), (e) are histograms and standard deviation corresponding to R, G, B color of image 9a; (b), (d), (f) are histograms and standard deviation ... view Left Camera Right Camera Left Image Right Image Common Image Left Image Right Image Good Image Diagram Two-camera system 2.2.The Positional Relationships of Two Cameras Human visual system...
- 10
- 297
- 0
half year report 1999 good half-year results with a further increase in net income the holderbank group confirms its strength and flexibility in the face of rapidly changing market conditions
... international finan- also making considerable headway on cial markets, Central America and parts various projects The doubling of ca- of the Caribbean reported positive pacity at the Midlothian plant ... South Africa has plants in Nicaragua and the Dominican set stability and continuity as its pri- Republic and the sale of the Brazilian mary goals, demand was generally concrete chemicals unit weak ... Grupo Incsa-PC in Costa economy and a massive currency Rica turned in a very favorable perfor- devaluation in Ecuador As a result, mance, with cement sales up by an im- coastal infrastructure...
- 35
- 314
- 0
Báo cáo khoa học: " Motion compensation with a scanned ion beam: a technical feasibility study" pps
... Shirato H, Harada T, Harabayashi T, Hida K, Endo H, Kitamura K, Onimaru R, Yamazaki K, Kurauchi N, Shimizu T, Shinohara N, Matsushita M, aka-Akita H, Miyasaka K: Feasibility of insertion/implantation ... Shinohara N, Harabayashi T, Tsukamoto T, Koyanagi T, Miyasaka K: Use of an implanted marker and real-time tracking of the marker for the positioning of prostate and bladder cancers Int J Radiat Oncol ... investigate the potential of target tracking with a scanned ion beam [4,20] In beam's eye view, lateral motion adaptation of pencil beam positions is feasible by applying offsets to the raster scanner...
- 7
- 240
- 0
Báo cáo y học: "Direct electrochemical analyses of human cytochromes b5 with a mutated heme pocket showed a good correlation between their midpoint and half wave potentials" doc
... for A5 9V, A5 9V-R (5’-CCTCAAAGTTCTCAGTAACGTCACCTCCAGCTTG-3’) and A5 9V-F (5’-CAA GCTGGAGGTGACGTTACTGAGAACTTTGAGG-3’); for A5 9 S, A5 9S-R (5’-CAAGCTGGAGGTGACTCTACTGAGAACTTTGAGG-3’) and A5 9S-F (5’-CA ... (5’CCAGCTTGTTCCCTGATAACTTCTTCCCCACC-3’) and L51I-F (5’-GGTGGGGAAGAAGTTATCAGGGAACAAGCTGG-3’); for L51T, L51T-R (5’-CCAGCTT GTTCCCTTGTAACTTCTTCCCCACC-3’) and L51T-F (5’-GGTGGGGAAGAAGTTACAAGGGAACAAGCT ... (5’-CA AGCTGGAGGTGACTCTACTGAGAACTTTGAGG3’); for G6 7A, G6 7A- R(5’-GGCATCTGTAGAGTGCGCGACATCCTCAAAGTTC-3’) and G6 7A- F (5’-GAAC TTTGAGGATGTCGCGCACTCTACAGATGCC-3’); and for G67 S, G67S-R (5’-GGCATCTGTAGAGTGCGAGACATCCTCAAAGTTC-3’)...
- 15
- 477
- 0
Báo cáo y học: "Phase delaying the human circadian clock with a single light pulse and moderate delay of the sleep/dark episode: no influence of iris color" potx
... African Americans had larger phase advances than Caucasians Because we found that African Americans had a shorter tau than Caucasians, which would augment phase advances relative to the Caucasians ... manuscript we also re-analyzed data from our previous phase-advancing study with daily light pulses [42] that included both light and dark-eyed Caucasians as well as dark-eyed African Americans, and thus ... had larger phase advances than Caucasians (n = 11) [40], suggesting that race, not iris color, was a factor mediating the magnitude of circadian phase shifts Although there are racial differences...
- 7
- 314
- 0
Báo cáo y học: " Transient basilar artery occlusion monitored by transcranial color Doppler presenting with a spectacular shrinking deficit: a case report" ppt
... as the only Author details Geriatric Department, Madonna delle Grazie Hospital, via Cattedra Ambulante 75100 Matera, Italy 2Neurology Department, Madonna delle Grazie Hospital, Via Cattedra Ambulante, ... basilar artery: a pulsatile flow with normal flow acceleration and decreased mean flow velocity (>30% difference between the proximal and distal arterial segments) unremarkable A transcranial ... The dampened flow is a typical sign of recanalization in the case of intracranial artery occlusion [3,4] A transcranial Doppler with transtemporal approach showed normal findings on middle, anterior...
- 4
- 161
- 0
Báo cáo y học: " Hypertrophic osteoarthropathy as the cause of a super scan of the bone in a patient with prostate cancer: a case report" pps
... compensated respiratory acidosis with an oxygen saturation of 80% Electrocardiography showed atrial fibrillation with a left bundle branch block, similar to earlier ECGs Chest X-ray revealed a large ... pleural fluid was performed A total amount of 4.5 liters was evacuated Cytological and biochemical analysis showed only lymphocytosis with no signs of malignancy or bacterial infection Auramin and ... clinical diagnosis There was a large undifferentiated non-small cell lung carcinoma with a diameter of 10 cm and extension in the adventitia of the esophagus and lymphatic metastasis in the hili and...
- 6
- 353
- 0
Báo cáo sinh học: "Mapping Quantitative Trait Loci (QTL) in sheep. III. QTL for carcass composition traits derived from CT scans and aligned with a meta-assembly for sheep and cattle carcass QTL" pot
... muscle area was estimated by averaging the area of muscle at the closest image to the first lumbar and the next caudal image Percentages of lean, fat and bone were calculated as a percentage of ... Polish Black-andWhite cattle Meat Sci 2006, 72:539-544 67 Takasuga A, Watanabe T, Mizoguchi Y, Hirano T, Ihara N, Takano A, Yokouchi K, Fujikawa A, Chiba K, Kobayashi N, et al: Identification of ... for growth and carcass traits in Japanese Black cattle by replication and identical-by-descent mapping Mamm Genome 2007, 18:125-136 68 Mizoshita K, Takano A, Watanabe T, Takasuga A, Sugimoto...
- 14
- 357
- 0
Báo cáo y học: "Normalization of boutique two-color microarrays with a high proportion of differentially expressed probes" ppt
... throughput assay to systematically interrogate genes of maximal interest at low cost [6,7] Boutique arrays are almost always two -color cDNA arrays because cDNA arrays are the easiest to customize and ... Boutique arrays are custom-made arrays that may contain only a few score genes With such small arrays it is easy to step beyond the tolerance of lowess normalization, particularly as genes are often ... Cleveland WS: Robust locally weighted regression and smoothing scatterplots J Am Statistical Assoc 1979, 74:829-836 Tanaka TS, Jaradat SA, Lim MK, Kargul GJ, Wang X, Grahovac MJ, Pantano S, Sano...
- 8
- 166
- 0
Drawing - Fun With A Pencil
... can trace a photo, and draw from the tracing, or take any of your own drawings and distort them Here again is a chance for your own invention Draw a square around your subject Divide each way ... Nevertheless, we can take as a basic form a ball sliced off at the sides, leaving it a little wider one way than the other, and adding to it or taking some away The forehead may be flattened, cut ... make any allowance for the variety of shapes 36 After this book was published, I learned with interest that a similar basic head form has been used for years by Miss E Grace Hanks of the Pratt...
- 123
- 1,965
- 6
Cambridge.University.Press.Learning.Medicine.How.to.Become.and.Remain.a.Good.Doctor.Jan.2008.pdf
... compulsory and Pre-Medical course available UKCAT compulsory AAA AAB AAA 370 tariff points AAAa AAB Newcastle Nottingham Oxford Peninsula Queens University, Belfast Sheffield Acceptable on its own and ... applicants with qualifications from England, Wales and Northern Ireland BMAT compulsory Graduate entry and Pre-Medical course available UKCAT compulsory Graduate entry available Graduate entry available ... available UKCAT compulsory UKCAT compulsory Other Info AAA AAB AAAb AAB Dundee East Anglia Edinburgh Glasgow Guy’s, King’s AABc and St Thomas’, 370 tariff points Cardiff Acceptable on its own and combined...
- 246
- 853
- 4
Báo cáo y học: " Non-syndromic multiple supernumerary teeth in a family unit with a normal karyotype: case report"
... investigation and after the assessment of 380 radiographic exams, such as X-Ray Dental Panoramic Tomogram and Denta -Scan (Fig 6) of the inferior maxillary bone Exodontia led to remission of the algic ... patient reported localized pain and a slight homolateral submandibular lymphadenopathy, without functional limitations or fever No occlusal hindrance was caused by these supernumerary teeth Although ... investigated, and the operation will be planned with as little trauma as possible, in order to preserve the hard and soft surrounding structures Clinical case A 30 years old Caucasian patient came...
- 7
- 597
- 0
Báo cáo y học: " Evaluation of Lumbar Facet Joint Nerve Blocks in Managing Chronic Low Back Pain: A Randomized, Double-Blind, Controlled Trial with a 2-Year Follow-U"
... bupivacaine with or without Sarapin Group II = bupivacaine and steroids with or without Sarapin WC = Workers compensation MVA = Motor vehicle injury Analysis of Data Numbers Analyzed Data were analyzed ... C-fibres Acta Anaesthesiol Scand 1990; 34: 335-8 69 Pasqualucci A, Varrassi G, Braschi A, et al Epidural local anesthetic plus corticosteroid for the treatment of cervical brachial radicular pain: ... 20: 539-45 Schwarzer AC, Wang SC, Bogduk N, et al Prevalence and clinical features of lumbar zygapophysial joint pain: A study in an Australian population with chronic low back pain Ann Rheum Dis...
- 12
- 669
- 0
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
... Yamaguchi H, Sasaki K, Satomi Y, Shimbara T, Kageyama H, Mondal MS, Toshinai K, Date Y, Gonzalez LJ, Shioda S, Takao T, Nakazato M, Minamino N Peptidomic identification and biological validation of ... Cruz Biotech, CA) The assay was developed using a stabilized HRP substrate All samples were analyzed in the linear range of the ELISA using over-expressed human Vgf as a standard Assessment of ... Lange DJ, Voustianiouk A, Macgrogan D, Ho L, Suh J, Humala N, Thiyagarajan M, Wang J, Pasinetti GM A ketogenic diet as a potential novel therapeutic intervention in amyotrophic lateral sclerosis...
- 8
- 499
- 0
What To Do If Trapped In A Lift With A Dentist
... consciousness? Watched the telly? Had an argument? Made a sandwich? Started a war? If we're a species apart then why we behave like animals? Because we are animals we're monkeys with delusions In anthropocentric ... relaxation CD that appears to be voiced by Ian Paisley A pair of trainers pickled in bree A vague sense of inadequacy A perambulating hamster nailed to the knee of a disgruntled member of a select ... alone it teaches us nothing except how to repeat past mistakes again and again and again WAR War what is it good for? Reinvigorating depressed economies and winning elections MIDDLE CLASS LAND Some...
- 34
- 515
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25