repair of a worn turbine engine shaft by thermal spraying
Effect of unsaturated fatty acid esters of biodiesel fuels on combustion, performance and emission characteristics of a DI diesel engine
Ngày tải lên :
05/09/2013, 15:28
... percentage of unsaturation, maximum heat release rate and peak pressure for karanjia biodiesel Biodiesel of karanjia has a lower percentage of unsaturation and has a higher value of maximum heat ... and exhaust gas temperature was observed in case of high unsaturated biodiesel Heat release rate and cumulative heat release rate is lower in case of high- unsaturated biodiesel fuel A general ... properties and combustion parameters "X" variable % of Unsaturation Density Cetane number Heating value Iodine value "Y" variable Start of dynamic injection bTDC Ignition delay Maximum heat release rate...
- 20
- 483
- 0
Finite time exergoeconomic performance optimization of a thermoacoustic heat engine
Ngày tải lên :
05/09/2013, 16:10
... efficiency of a traveling wave heat engine J Acoust.Soc Am., 1982, 7(3): 1239-1243 [3] Yazaki T, Iwata A, mackawa T and Tominaga A Traveling wave thermoacoustic engine in a looped tube Phys Rev Lett., ... / F1 and FT = F1 + F2 Here, the total heat transfer surface area FT of the two heat exchangers is assumed to be a constant (3) There is a constant rate of heat leakage ( q ) from the heat source ... transfer coefficient and F2 is the total heat transfer surface area of the cold-side heat exchanger Here the & &′ imaginary part n2 of n indicates the relaxation of a heat transfer process Defining...
- 14
- 411
- 0
Optimization of injection timing and injection pressure of a DI diesel engine fueled with preheated rice bran oil
Ngày tải lên :
05/09/2013, 16:11
... Deepak Agarwal, Avinash Kumar Agarwal, Performance and emissions characteristics of Jatropha oil (preheated and blends) in a direct injection compression ignition engine, Applied Thermal Engineering ... Rice G Performance of rapeseed oil blends in diesel engines Journal of Applied Energy 1996;64(4): Agarwal D.; Lokesh Kumar, and Agarwal, A. K 2008 Performance evaluation of a vegetable oil fuelled ... southern Asia, and it is a staple food for a large part of the world’s human population especially in east, south and south-east Asia, making it the most consumed cereal grain Rice bran oil is extracted...
- 10
- 551
- 0
Báo cáo khoa học: Observation of a chaotic multioscillatory metabolic attractor by real-time monitoring of a yeast continuous culture doc
Ngày tải lên :
07/03/2014, 10:20
... treat each variable as a separate time series due to the lack of suitable methods for analyzing the dynamical properties of multidimensional data sets We would encourage our mathematical colleagues ... relative phases of the two waves Fast oscillations There is at least one fast oscillatory component with a period of $ which, like the circahoralian rhythm, appears, disappears and reappears at ... was computed for each window and normalized to make the area under each of these curves identical Some of the analysis relies on a time-delay embedding of the O2 data, i.e on analysis of data...
- 8
- 242
- 0
Bipolar Disorder – A Portrait of a Complex Mood Disorder Edited by Jarrett Barnhill docx
Ngày tải lên :
08/03/2014, 00:20
... signaling and a elevated protein kinase A activity ( Langan & McDonald 2009 ) The calcium channels antagonists (verapamil and others) raise carbamazepine effect Magnesium, acting like a natural calcium ... increases the verapamil maintenance therapy in mania (Giannini et al 2000) This fact favors the idea that an increase in magnesium concentration is an important fact, maybe essential for the therapeutic ... increased in animal models of mania produced by amphetamine administration .Chronic amphetamine treatment is associated with an imbalance in SOD and CAT activity In experimental studies in rats...
- 250
- 431
- 0
Báo cáo Y học: Determinants of the inhibition of a Taiwan habu venom metalloproteinase by its endogenous inhibitors revealed by X-ray crystallography and synthetic inhibitor analogues pdf
Ngày tải lên :
08/03/2014, 23:20
... proteinases are also shown Academia Sinica (Taipei, Taiwan) for assistance in the chemical synthesis of inhibitor analogues We thank Dr Yuch-Cheng Jean of the Synchrotron Radiation Research Center ... mechanism of snake-venom metalloproteinases by endogenous inhibitors, as well as providing an initial model for the rational design of inhibitors against disease-related ADAMs and MMPs, such as ... They are generally called ADAMs (a disintegrin-like and metalloproteinase domain) with the same central catalytic domain as SVMPs and MMPs, especially at the active-site structure [21,22] A well...
- 10
- 475
- 0
Báo cáo khoa học: Trans-splicing of a mutated glycosylasparaginase mRNA sequence by a group I ribozyme deficient in hydrolysis pptx
Ngày tải lên :
23/03/2014, 13:20
... AGU and DiGIR2DP9.2 AGU band Additional bands result from degradation of RNA during incubation at trans-splicing and RPA hybridization conditions Below; quantitation of RPA of trans-spliced GA ... RNA in analysis by RPA The transcribed RPA probe was 500 nt (Fig 4B) RPA samples were separated on M urea/5% polyacrylamide gels, followed by autoradiography (Fig 3B) and phosphoimager quantitation ... reprogrammed product (RNA 2) + target GA RNA (RNA 3) The amount of trans-splicing ribozymes that had undergone the reaction [calculated as the amount of reprogrammed product (RNA 2) as a fraction...
- 7
- 307
- 0
Báo cáo Y học: Stabilization of a (ba)8-barrel protein by an engineered disulfide bridge potx
Ngày tải lên :
24/03/2014, 03:21
... replacing both Ile64 and Met240 by Cys: I64C 5Â primer, 5Â-AAAG GCGTGTGTCGTGATGATTTCGATCCA-3Â; I64C 3Â primer, 5Â-GAAATCATCACGACACACGCCTTTTGA 3Â; M240C 5Â primer, 5Â-GCGTTGTGTGCCCATGACGAT TTG-3Â; M240C ... Processing of X-ray diffraction data collected in oscillation mode Methods Enzymol 276, 307326 Navaza, J (1994) An automated package for molecular replacement Acta Crystallogr A5 0, 157163 Brunger, A. T., ... same minima and maxima, indicating that they have a similar chiral environment for W15, which is the only tryptophan of the eIGPS domain, and partially accessible to solvent (ASA ẳ 48 A2 ) Furthermore,...
- 9
- 465
- 0
Báo cáo y học: "Genomic acquisition of a capsular polysaccharide virulence cluster by non-pathogenic Burkholderia isolates" pdf
Ngày tải lên :
09/08/2014, 20:22
... data Linkage analysis Bioinformatics 2000, 16:847-848 Ahmed K, Enciso HD, Masaki H, Tao M, Omori A, Tharavichikul P, Nagatake T: Attachment of Burkholderia pseudomallei to pharyngeal epithelial ... literature Phylogenetic analysis using both aCGH and MLST data revealed that the variant Bt strains occupy part of an evolutionary clade that is genetically distinct from the majority of Bt strains ... in Additional file Page 13 of 17 Array-based comparative genomic hybridization and data analysis Genomic DNAs were labeled with either Cy3 or Cy5 fluorescence dyes using a bacterial artificial...
- 17
- 367
- 0
Báo cáo y học: "ransternal repair of a giant Morgagni hernia causing cardiac tamponade in a patient with coexisting severe aortic valve stenosis" pdf
Ngày tải lên :
10/08/2014, 09:23
... S, Paranon S, Le Mandat A, Galinier P, Dulac Y, Acar P: Morgagni hernia causing cardiac tamponade Arch Pediatr 2010, 17:1465-1468 Paris F, Tarazona V, Cassilas M: Hernia of Morgagni Thorax 1973, ... hemostasis Conclusively, Morgagni hernia can rarely accompany several cardiac surgical pathologies Cardiac surgeons should be familiar with the transsternal hernia repair which is as effective as ... Simultaneous operation in a patient with coronary heart disease, abnormal orifice of coronary arteries, morgagni hernia, atrial septal defect, and pericardial and pleural agenesis Heart Surg Forum...
- 5
- 258
- 0
báo cáo khoa học: " Thoracoscopic-assisted repair of a bochdalek hernia in an adult: a case report" pptx
Ngày tải lên :
11/08/2014, 02:22
... defect of diaphragm was closed and again sutured to the thoracic wall under small thoracotomy without a prosthetic patch One of the advantages of a thoracoscopic repair of a Bochdalek hernia is that ... Esmer D, Alvarez-Tostado J, Alfaro A, Carmona R, Salas M: Thoracoscopic and laparoscopic repair of complicated Bochdalek hernia in adult Hernia 2008, 12:307-309 10 Kocakusak A, Arikan S, Senturk ... presenting as splenic rupture in an adult Ann Thorac Surg 2006, 81:e9-e10 Al-Emadi M, Helmy I, Nada MA, Al-Jaber H: Laparoscopic repair of Bochdalek hernia in an adult Surg Laparosc Endosc Percutan Tech...
- 5
- 241
- 0
báo cáo khoa học: " Review of "In the Eye of the Needle: Diary of a Medically Supervised Injecting Centre" by Ingrid van Beek Allen & Unwin 2004" potx
Ngày tải lên :
11/08/2014, 20:20
... for Vancouver, Canada) and injection centres are taking the path of other interventions for drug users in that they will be adopted gradually at a glacial pace I would love to see a spate of books ... centre talked about the lack of blood awareness and the poor injection techniques of injectors, despite years of education by providers Investigation by staff at the centre revealed that education ... doesn't occur in any other circumstance By treating an overdose so early in its course, the damage already done and its natural progression is reversed so that Narcan (used to start breathing) will...
- 3
- 191
- 0
Báo cáo y học: " Inactivation of tumor suppressor Dlg1 augments transformation of a T-cell line induced by human T-cell leukemia virus type 1 Tax protein" ppsx
Ngày tải lên :
13/08/2014, 09:20
... 5'gtgttcagtctgtacgagaTTCAAGAGAtctcgtacagactgaacacTTTTT-3' for hDlg1-3, 5'gagtggatgccacgacggtttGTGTGCTGTCCaaatcgtcgtggtattcactcTTTTT-3' for CAT, 5'-ggcctttcactgctcctgcgaGTGTGCTGTCCtcgtaggagtagtgaaaggccTTTTT-3' ... 5'-ggatggcgagctttaggttggGTGTGCTGTCCccaatctgaagcttgccatccTTTTT-3' for Dlg1-1, 5'ggatgtttaggagtataagttGTGTGCTGTCCaacttatgctcctgaatatccTTTTT-3' for Dlg1-3, 5'-gaaagaacgagcccgattaTTCAAGAGAtaatcgggctcgttctttcTTTTT-3' for hDlg1-1, 5'gtgttcagtctgtacgagaTTCAAGAGAtctcgtacagactgaacacTTTTT-3' ... 337(1):191-194 Iwanaga Y, Tsukahara T, Ohashi T, Tanaka Y, Arai M, Nakamura M, Ohtani K, Koya Y, Kannagi M, Yamamoto N, Fujii M: Human T-cell leukemia virus type tax protein abrogates interleukin-2...
- 13
- 397
- 0
Báo cáo sinh học: "Improve protective efficacy of a TB DNA-HSP65 vaccine by BCG priming" pdf
Ngày tải lên :
14/08/2014, 19:22
... 60 days after the last immunization, mice were challenged through instillation of bacterial solution (105 bacteria/animal) by intratracheal route according to harmonization procedures of animals ... were stained with hematoxylin-eosin and the granulomatous lesions were analyzed by light microscopy (Leica, Germany) Statistical analysis All data were analyzed individually and the values were ... ITB and APSM in the laboratory of CLS and the Company Farmacore Biotecnologia Ltda, who also shared their expertise in the DNA vaccine The majority of the research was done in the laboratory of...
- 14
- 144
- 0
Báo cáo khoa học: Uptake of bilirubin into HepG2 cells assayed by thermal lens spectroscopy Function of bilitranslocase doc
Ngày tải lên :
07/03/2014, 21:20
... Experimental procedures The uptake assay was carried out at 37 °C (circles and squares) and at °C (triangles) Data are mean ± SEM (n ¼ 4) The inset shows the raw data obtained by thermal lens spectrometry ... cells by a carriermediated mechanism When bilitranslocase was assayed as the carrier catalysing the electrogenic BSP uptake in rat liver plasma membrane vesicles, it was shown to be inhibited by an ... Colloidal gold particles appear as white spots, locating the epitope of the bilitranslocase targeted by antibody A Similar results were also obtained in primary rat hepatocytes and again in both...
- 14
- 369
- 0
Morphology and growth mechanism study of self assembled silicon nanowires synthesized by thermal evaporation
Ngày tải lên :
16/03/2014, 15:06
... precipitation and results in the formation of SiNWs made of a Si core and a SiO2 sheath The one-dimensional growth of SiNWs is facilitated by the SiO2 sheath that con®nes the lateral growth of SiNWs, ... there are also some small particles with irregular shapes These particles are connected by many relatively straight SiNWs of uniform diameter as strands, as shown in Fig 3b Images at higher magni®cation ... the main branch of SiNWs, and its diameter increases gradually to form the bulb at its tip HREM results reveal that the mainand sub-branches of SiNWs are clothed with a SiO2 out-layer of a few...
- 7
- 463
- 1
Báo cáo y học: "Mutations in matrix and SP1 repair the packaging specificity of a Human Immunodeficiency Virus Type 1 mutant by reducing the association of Gag with spliced viral RN" ppsx
Ngày tải lên :
13/08/2014, 01:20
... splicing of viral RNA (A) Dimerization analysis of virion RNA Virion RNAs of different proviral constructs were separated on a native agarose gel and characterized by Northern analysis Dimer and monomer ... likely package other RNA species to replace the decreased amount of HIV-1 genomic and spliced RNA Reduction of HIV-1 genomic RNA is accompanied by an increase in packaging of cellular RNA into ... mRNA compared to the wild type; 3- to 5-fold less HIV-1 mRNA was associated with the revertant Figure Characterization of the association between Gag and HIV-1 RNA (A) Measurement of the association...
- 12
- 300
- 0
Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"
Ngày tải lên :
25/10/2012, 09:56
... safety) Materials and methods Stavanger HEMS The Stavanger HEMS is part of the national HEMS system of Norway, and its primary areas of operation are the mixed urban and rural districts of Rogaland ... Norwegian Air Ambulance Foundation Author details Department of Research and Development, Norwegian Air Ambulance Foundation, Drøbak, Norway 2Department of Anaesthesiology and Intensive Care, Stavanger ... Science Data Service approved the collection and recording of the study data Statistics Data were recorded into a database designed with File Maker (FileMaker Inc., Santa Clara, CA, USA) We used Table...
- 6
- 611
- 0
Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR
Ngày tải lên :
05/09/2013, 10:15
... gacccgatgttcaagatact ctcctcccacaaatcaggac Saito et al., 2003b QMF QMR QMT (Probe) agacgcacgctcacctcaa gagcagttcacgaaatcc atacgctcttactgtttccggccgcc in this study BACT1369F PROK1492R TM1389BACT2 ... blue-green algae, Microcystis, Anabaena, Oscillatoria and in lake Kasumigaura Environ.Tech., 14, 433-442 Park H.-D., Iwami C., Watanabe M F., Harada K.-I., Okino T and Hayashi H (1998) Temporal variabilities ... 61-72 Park H D., Sasaki Y., Maruyama T., Yanagisawa E., Hiraishi A and Kato K (2001) Degradation of the cyanobacterial hepatotoxin microcystin by a new bacterium isolated from a hypertrophic lake...
- 9
- 522
- 0
Ecological performance of a generalized irreversible Carnot heat engine with complex heat transfer law
Ngày tải lên :
05/09/2013, 15:28
... The total heat transfer surface area ( F ) of the two heat exchangers is assumed to be a constant: F = F1 + F2 (3) There exists a constant rate of bypass heat leakage ( q ) from the heat source ... heat transfer coefficient and F1 is the heat-transfer surface area of the hightemperature-side heat exchanger , β is the overall heat transfer coefficient and F2 is the heat-transfer surface area ... endoreversible and regenerative gas -turbine power-cycle Appl Energy, 2005, 81(1):73-84 [28] Ust Y, Safa A, Sahin B Ecological performance analysis of an endoreversible regenerative Brayton heat -engine Appl...
- 14
- 534
- 0