reliable and specific protein function prediction by combining homology with genomic s g ntext
Báo cáo y học: "Consistent dissection of the protein interaction network by combining global and local metrics" ppt
Ngày tải lên :
14/08/2014, 08:20
... Additionaldataset algorithms of a yeast transcriptional subdataset different Acknowledgements This research is supported by the program Molecular Assemblies, Genes, and Genomics Integrated Efficiently (MAGGIE) ... TRA1 GCN5 TAF1 GCN4 NUT1 SRB8 SPT15 SIN4 NGG1 TAF5 SSN3 SSN8SSN2 UBP8 SPT20 TAF12 TAF7 TAF3 SGF11 TAF2 HFI1 TAF6 SPT3 TAF8 SGF29 TAF4 ADA2 SGF73 TAF13 TAF11 CCR4 SUS1 TOA2 CDC31THP1 TOA1 SAC3 ... contains 1,078 proteins and 9,919 interactions To evaluate the robustness to false positives and false negatives, we derived 16 altered networks by randomly removing edges from or adding edges to...
- 13
- 378
- 0
Báo cáo khoa hoc:" Rapid and specific influenza virus detection by functionalized magnetic nanoparticles and mass spectrometry" pdf
Ngày tải lên :
11/08/2014, 08:20
... has the potential for integration into high-throughput virus assays, suggesting a promising application in early and accurate diagnosis of influenza viruses Given the increasing use of virus screening ... viruses and rapid screening of virus subtypes The specificity of HA enrichment was confirmed by sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) and peptide mass sequencing using ... Dis 2008, 52:124–129 14 Mandenius CF, Wang R, Aldén A, Bergström G, Thébault S, Lutsch C, Ohlson S: Monitoring of influenza virus hemagglutinin in process samples using weak affinity ligands and...
- 44
- 223
- 0
Báo cáo y học: " Protein function annotation by homology-based inference" pps
Ngày tải lên :
14/08/2014, 21:20
... providing predictors with target protein sequences whose structure is soon to be determined and setting up a system for blindly assessing the results Distributed Annotation System (DAS) Communication ... of essentially complete genome sequences is COG (Clusters of Orthologous Groups), an evolutionary classification that uses comparative genomics principles, such as phyletic profiles [23] (see ... scanned using SPASM [41] The DRESPAT [42] algorithm also identifies patterns within a family of proteins The resulting structural motifs can be used to identify binding sites and to assign function...
- 8
- 115
- 0
Graph based methods for protein function prediction
Ngày tải lên :
12/09/2015, 08:18
... associations from top BLAST hits against yeast genome (BLAST_SGD); 4) IWA using binary associations from top BLAST hits against multiple genomes (BLAST_ALL); 5) IWA using binary associations from all sources ... heterogeneous sources with GeneFAS, GAIN, IWA and IWA with cross -genomic information (IWA*) (right) 144 Figure 5-4 1) Precentage of known GO annotations for biological process that is suggested ... BLAST hits against yeast genome (BLAST_SGD TOP); 2) function transfer from top BLAST hits against multiple genomes (BLAST_ALL TOP); 3) Integrative Weighted Averaging (IWA) using binary associations...
- 192
- 164
- 0
báo cáo hóa học:" Application of a disease-specific mapping function to estimate utility gains with effective treatment of schizophrenia" pot
Ngày tải lên :
20/06/2014, 15:20
... Pos Pos Pos Pos Cog Cog Cog Cog Cog Cog Neg Neg Pos Pos Cog Cog Level of Impairment Low Moderate High Figure Symptom description for the eight health states used in the PANSS-based mapping function ... function Symptom description for the eight health states used in the PANSS-based mapping function PANSS indicates Positive and Negative Syndrome Scale; Neg, negative symptoms; Pos, positive symptoms; ... VAS indicates visual analog scale; SEM, standard error of the mean; SG, standard gamble *P < 0.001 versus baseline visual-analog-scale measurement (Wilcoxon signed rank test) †P < 0.001 versus...
- 8
- 374
- 0
Báo cáo y học: "Decreased levels of soluble amyloid β-protein precursor and β-amyloid protein in cerebrospinal fluid of patients with systemic lupus erythematosus" ppsx
Ngày tải lên :
09/08/2014, 01:23
... CNS lupus as the presence of at least two of the following seven items occurring in association with clinical evidence of disease progression: recent onset psychosis, transverse myelitis, aseptic ... infarctions MRI abnormalities were seen in 67% of cases with CNS lupus and in 30% of SLE cases classified as cerebrally healthy Neuropsychological assessment The neuropsychiatric tests were carried ... 74:837-844 13 Hirohata S, Hirose S, Miyamoto T: Cerebrospinal fluid IgM, IgA, and IgG indexes in systemic lupus erythematosus Their use as estimates of central nervous system disease activity Arch...
- 8
- 342
- 0
Báo cáo y học: " Fluorodeoxyglucose-positron emission tomography/computed tomography in the staging and evaluation of treatment response in a patient with Castleman''''s disease: a case report" pps
Ngày tải lên :
11/08/2014, 23:21
... decreased suggesting, together with clinical signs, a complete disease response Conclusion This case report shows that FDG-PET/CT could have an important role in the staging of Castleman 's disease and ... Castleman 's disease, as with aggressive lymphomas and many solid tumours, presents an increase in glucose metabolic activity Therefore, PET study can lead to a more precise staging of the disorder ... the same session, with a dual gain in diagnostic accuracy Staging is crucial in the identification of the appropriate treatment in Castleman 's disease CT or magnetic resonance imaging (MRI) is...
- 4
- 360
- 0
Protein function and inhibitor prediction by statistical learning approach
Ngày tải lên :
16/09/2015, 08:31
... the prediction system for assigning functional class of proteins without any sequence similarity in protein sequence databases and proteins with similar sequence but different functions, novel proteins ... resistance and many physiological side effects Thus it is in high demand for speeding up drug discovery in the fight against with HIV infections by properly choosing HIV PIs candidates In this study, ... increasing along with the progress of genomics and proteomics Resulting from large-scale genome sequencing projects, the gap between the large amounts of sequences information and their function...
- 181
- 527
- 0
Tài liệu Báo cáo khoa học: Inhibition of glyceraldehyde-3-phosphate dehydrogenase by peptide and protein peroxides generated by singlet oxygen attack docx
Ngày tải lên :
21/02/2014, 03:20
... all cases signicance was assumed if P < 0.05 RESULTS Formation of peptide and protein peroxides Photolysis of solutions containing rose bengal and N-AcTrp-OMe, Gly-His-Gly, Gly-Tyr-Gly, lysozyme ... concentrations were determined by a modied FOX (FeSO4/xylenol orange) assay, using H2O2 standards [36] This assay gives similar values to iodometric analysis (A Wright, C L Hawkins & M J Davies, unpublished ... active site Cys residues (i.e reaction 1, see below) This is supported by the observations, with GAPDH, that thiol group loss occurs with similar kinetics to peroxide loss, and that blocking of...
- 10
- 462
- 0
Báo cáo khoa học: Protein aggregation and amyloid fibril formation prediction software from primary sequence: towards controlling the formation of bacterial inclusion bodies pot
Ngày tải lên :
06/03/2014, 00:20
... amyloidoses Furthermore, the introduction of aggregation-disrupting amino acid substitutions in the aggregationprone ⁄ amyloidogenic short sequence regions suggests the possibility of fine-tuning and ... of [41] and references therein) Most of these proteins are included in Table S1 This suggests the exciting possibility of performing in silico (producing suitably designed variants, especially ... Performing two single amino acid substitutions in the IAPP sequence (V1 7G and F2 3G, arrows), the AMYLPRED output suggests that the protein has ‘lost’ two, crucial, amyloidogenic determinants ⁄ ’aggregationprone’...
- 8
- 415
- 0
Báo cáo khoa học: Inhibition of an iron-responsive element/iron regulatory protein-1 complex by ATP binding and hydrolysis docx
Ngày tải lên :
07/03/2014, 09:20
... not shown), supports specificity of the binding site (s) A large excess of unlabeled ATP was necessary to eliminate the signal The reason for this is unknown, but it has been observed previously ... ATP solutions ranging from 10 to 750 nm Statistical methods Filter-binding assay ATP-binding activity was determined by a filter-binding assay as previously described [53] IRP-1 (0.5–1 lg) was incubated ... iron-regulatory factor functions as an iron-responsiveelement-binding protein, a translational repressor and an aconitase A functional assay for translation repression and direct demonstration...
- 12
- 448
- 0
Báo cáo khoa học: Activation of nematode G protein GOA-1 by the human muscarinic acetylcholine receptor M2 subtype Functional coupling of G-protein-coupled receptor and G protein originated from evolutionarily distant animals doc
Ngày tải lên :
07/03/2014, 11:20
... ACATAGGCGCTACAAGGATGGGTTGTACCATGTC ACAGGAAG-3¢; M2-goa1-PstI-as, 5¢-CCAATGCATTGG TTCTGCAGTTAATACAAGCCGCATCCACGAAGA-3¢ (An engineered PstI recognition site is single-underlined The overlapping region ... M2-myc-EcoRI -s, 5¢-CAGAATTCatg gagcagaagctgatctccgaggaggacctgctgGTGAACAACTCCAC CAACTCCTCCAACAACTCCCTGGCTCTTACAAGTC CTTATAAGACA-3¢; HsM2-as, 5¢-TTACCTTGTAGCG CCTATGTTCTTATAATG-3¢ (An engineered EcoRI ... Agonist-bound GPCRs are considered to interact with G proteins This interaction causes a decrease in the affinity for GDP of Ga and the subsequent substitution of GDP by GTP [10] Such an agonist-dependent...
- 9
- 400
- 0
Báo cáo khoa học: "Deciphering Foreign Language by Combining Language Models and Context Vectors" pdf
Ngày tải lên :
16/03/2014, 19:20
... Linguistics: Human Language Technologies, pages 12–21, Portland, Oregon, USA, June Association for Computational Linguistics Gerard M Salton, Andrew K C Wong, and Chang S Yang 1975 A vector space ... iterations using a 2-gram or 3-gram language model in the target language With the obtained best translations we induce new translation candidates using context similarity This procedure is depicted ... dealing with a manyto-many assignment that needs to satisfy the maximum number of candidates constraints For this, we solve the problem in a greedy fashion by simply choosing the best pairs (e,...
- 9
- 352
- 0
Báo cáo khoa học: "Text Chunking by Combining Hand-Crafted Rules and Memory-Based Learning" pot
Ngày tải lên :
17/03/2014, 06:20
... Korea Postposition : POSS Sejong base and the surrounding base Postposition: TOPIC western South Pole south Shetland Postposition : POSS King George Island Postposition : LOCA is located Ending : ... natural language processing Since the method is general enough, it can be applied to other problems such as POS tagging and PP attachment The memory-based learning showed good performance in these problems, ... a phrase whereas the remaining 81 cases form two phrases in4 Else If P OS(wi1 ) = noun and wi1 has a possessive postposition Then yi = I-NP dependently Thus, it can be said that the possibility...
- 8
- 393
- 0
Báo cáo khoa học: A1–Protein Function and Ageing pptx
Ngày tải lên :
23/03/2014, 15:20
... accounts for the broad substrate diversity of GSTs There are several classes of GSTs, the enzyme studied in this project belongs to the Mu-class and is designated GST M2-2 In the active site of GST ... PRESTO, Suita, Osaka, Japan E-mail: hyongi@mls.eng.osaka-u.ac.jp Many organisms possess multiple RNase H genes in their genomes For example, the Bacillus subtilis genome possesses three RNase ... peptide synthetases of various fungi taking part in siderophore biosynthesis Besides sequence homologies, the sizes and domain structures of these genes were also similar to those responsible for...
- 72
- 425
- 0
Báo cáo khoa học: Regulation of maize lysine metabolism and endosperm protein synthesis by opaque and floury mutations potx
Ngày tải lên :
23/03/2014, 15:21
... polypeptide spots visualized in 2D gels [34] Statistical analyses of zein isoform amounts A previous analysis of colloidal Coomassie blue staining intensity as a function of protein loading was carried ... corresponding to glutelins (Glu) + albumins + globulins; P, endosperm total proteins expressed as percentage of dry matter Soluble lysine is expressed as percentage of total soluble amino acids ... FEBS 2003 Fig Two-dimensional separation of zein isoforms isolated from the endosperms of maize seeds in the Oh43 background, using isoelectric focusing and SDS/PAGE Wild-type Oh43+ key isoforms...
- 11
- 354
- 0
Báo cáo khoa học: The enzymatic activity of SR protein kinases 1 and 1a is negatively affected by interaction with scaffold attachment factors B1 and 2 pot
Ngày tải lên :
30/03/2014, 01:20
... SRPK1, using as primers: forward: 5¢-GCGTGGATC CATGGAGCGGAAAGTGCTTGCG-3¢, containing the underlined BamHI site and reverse: 5¢-TCCCCCGGGAG CAGTACTGACTGCAGATCC-3¢, containing the underlined SmaI site ... – 37.5 GST 45- + + GST–SRPK1 GST–SRPK1 GST–SAFB1C 35- 25- C GST–SRPK1 GST–NtLBR + + + + + + + + + + 7.5 15 22.5 30 37.5 GST–NtLBR + + GST–SAFB1CΔRE ( g) GST–SRPK1 GST–SAFB1CΔRE D GST–SRPK1 + ... – – 37.5 GST ( g) GST GST–SAFB1C 35- 25- C FLAG–SRPK1a + + + + + + + + + GST–SAFB1C ( g) 7.5 22.5 37.5 – GST ( g) – – – – 37.5 GST–P2P-R + GST–P2P-R FLAG–SRPK1a GST GST–SAFB1C D FLAG–SRPK1a +...
- 16
- 573
- 0
Báo cáo khoa học: Transcription factor specificity protein 1 (SP1) and activating protein 2a (AP-2a) regulate expression of human KCTD10 gene by binding to proximal region of promoter pot
Ngày tải lên :
30/03/2014, 02:20
... GGGGTACCCGACGCACTACCGCCATCGT GGGGTACCCTTCTTCGCCCGGGAAGGAA GGGGTACCGCAGCTGAAATAGCGGAGGT GGGGTACCAACGGACGGCTTAAGACGTT GGGGTACCCCGGCTGGCGTGAGCTGGGT CCAAGCTTTTCCTTCCCGGGCGAAGAAG GGGGCGGAAGTGGGGTG GAAAAGTCGGAGGACG GGACTACCTGGAGTGATGCCTAA ... GGACTACCTGGAGTGATGCCTAA CCCATCAACGGTCTGGAACT GCUCCACCUCGAAGUACAATT NNAGCGCUUCAUGAGGAGUGA TTGCGGTTTAGGTACATCCA TGTGGCTCTGTGGAACATTT GGACTACCTGGAGTGATGCCTAA CCCATCAACGGTCTGGAACT CAACGTTACCCTGCTCACATCA ... chipR Sp1 ⁄ chipF Sp1 ⁄ chipR AP-2a ⁄ si Sp1 ⁄ si KCTD10FP KCTD10RP Sp1FP Sp1RP AP-2aFP AP-2aRP b-actinFP b-actinRP CCAAGCTTCGGACTGAGAGAGGCAGGAA GGGGTACCTGGAGCACACACGCCAGATC GGGGTACCCGACGCACTACCGCCATCGT...
- 11
- 409
- 0