region of interest coding for aerial video sequences using landscape models
Tài liệu The importance of interest rates for forecasting the exchange rate doc
... Rogoff (1983), we perform an out -of- sample forecasting exercise comparing the structural models to a random walk, using a rolling regression methodology That is, the models are first estimated using ... annual interest rate, we therefore need to multiply the quarterly interest rate by four Hence, if we had used an annual interest rate, the coefficient for the interest rate difference would be ¼ of ... performs better than the random walk at forecasting the exchange rate at all horizons The pure PPP model performs worst of all the three models at all horizons, and can therefore not outperform...
- 21
- 562
- 0
Báo cáo hóa học: " Research Article Distributed Temporal Multiple Description Coding for Robust Video Transmission" docx
... compare the four proposed MDC video coding schemes of Section They have been implemented using the MC-EZBC software [23] Three temporal levels of decomposition are performed for the two-band MCTF schemes ... for Foreman and Hall Monitor It performs better than the 3B MDC scheme for the smallest values of Qi (i < 4) and the higher bitrates (starting at around 300 kBit/s for Foreman and 60 kBit/s for ... incorporating this information into the packet header [9] In this situation, the initial scenario of binary “on/off ” channels might no longer be of interest For example, in a typical CIF-format video sequence,...
- 13
- 221
- 0
Limited resource visualization with region of interest
... Doctor of Philosophy Dept: Department of Computer Science Thesis Title: Limited resource visualization with region- of- interest Abstract This thesis studies some issues on applying region- of- interest ... A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF COMPUTER SCIENCE NATIONAL UNIVERSITY OF SINGAPORE 2006 LIMITED RESOURCE VISUALIZATION WITH REGION- OF- INTEREST YU HANG 2006 ... two regions: an emphasized region of high -interest, and the remaining suppressed region It is not necessary to have only two regions To achieve a smooth transition from high to low level of interest, ...
- 106
- 388
- 0
Nghiên cứu giải pháp gắn thông tin vùng hình ảnh Region Of Interest trong ảnh Y tế vào chuẩn tài liệu HL7 CDA và ứng dụng hiển thị thông tin lâm sàng trên Smartphone
... - RegionOfInterest Mục RegionOfInterest dẫn xuất từ lớp RIM Observation, biểu diễn vùng quan tâm hình ảnh, vùng quan tâm tham chiếu đến khu vực cụ thể hình ảnh Đơn vị đo giá trị tọa độ RegionOfInterest.value ... chụp vùng hình ảnh đặc biệt Regions Of Interest (ROIs) đến người nhận Khi nhận tài liệu, bác sỹ xem nội dung thông tin tài liệu, hình ảnh gửi kèm vùng hình ảnh Regions Of Interest điện thoại Smartphone ... truyền hình Communication System ảnh y khoa Referece Information Model Mô hình tham chiếu liệu bệnh viện Mô tả vị trí vùng ảnh ROI Regions Of Interest quan tâm hỗ trợ chẩn đoán bệnh giải phẫu học...
- 78
- 523
- 1
Báo cáo hóa học: " Research Article Flicker Compensation for Archived Film Sequences Using a Segmentation-Based Nonlinear Model" doc
... concepts for flicker compensation Firstly, the estimation of the flicker compensation profile is performed on regions of homogeneous intensity (Section 4) The incorporation of segmentation information ... possible to enhance the robustness and the accuracy of the method by performing flicker estimation of regions of homogeneous brightness The presence of outliers (Figure 5) is reduced in the compensation ... we divide a degraded block into regions of uniform intensity and then perform one compensation profile estimation per region Afterwards, the most reliable sections of the obtained profiles are combined...
- 16
- 238
- 0
Báo cáo hóa học: " Research Article Decoupled Estimation of 2D DOA for Coherently Distributed Sources Using 3D Matrix Pencil Method" pptx
... MP for GCD source MP for GCD source 20 0.4 0.2 25 CRB for GCD source CRB for GCD source 15 SNR (dB) 20 25 CRB for GCD source CRB for GCD source (22) So the variance of the unbiased estimate of ... ∂ϕi ∂ϕ j MP for GCD source MP for GCD source Figure 2: RMSE of azimuth angle for GCD sources 0.6 0.5 0 10 15 20 25 SNR (dB) MP for LCD source MP for LCD source CRB for LCD source CRB for LCD source ... diagonal element of the inverse of the Fisher information matrix Thus, we can compare the RMSE of the MP algorithm with var(ϕi ) to measure the goodness of the estimator 1.5 RMSE of azimuth angle...
- 7
- 224
- 0
Compression of 4d medical image and spatial segmentation using deformable models
... COMPRESSION OF 4D MEDICAL IMAGE AND SPATIAL SEGMENTATION USING DEFORMABLE MODELS YAN PINGKUN (B.Eng (Electronic Engineering), USTC) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF ... 2.3: Block diagram of transform coding In transform coding, compression is achieved by transforming the image, projecting it on a basis of functions, and quantizing and encoding the coefficients ... about seconds for lossless encoding/decoding each 3D frame of sequence A and seconds for sequence B 3.3.2 Progressive Compression Performance The lossy compression performance of our algorithm...
- 159
- 207
- 0
Tài liệu Halsted.Press.H.264.And.MPEG-4.Video.Compression.Video.Coding.For.Next.Generation.Multimedia.eBook-LiB docx
... GOP Group Of Pictures, a set of coded video images H.261 A video coding standard H.263 A video coding standard H.264 A video coding standard HDTV High Definition Television Huffman coding Coding ... program manager of video standards and technologies in the eHome A/V platforms group of Microsoft Corporation At Microsoft he designed and remains active in the extension of DirectX® Video Acceleration ... compensation and transform IEC International Electrotechnical Commission, a standards body Inter (coding) Coding of video frames using temporal prediction or compensation interlaced (video) Video data represented...
- 307
- 586
- 3
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt
... purification of recombinant MCoTI-II were followed the manufactures instruction of IMPACT-CN System, using chitin beads column chromatography [7] Results 3.1 Design and construction of the gene coding for ... introduced on the end of the proposed synthetic trypsin inhibitor gene The sequences of the forward and reversed primers are shown on fig and of the synthetic gene is on fig Forward primer: GAATTCCATATGAGCGGCAGCGATGGCGGCGTGTGCCCGA ... MCo DNA as template The conditions for this experiment were established as: 150ng of each primer; 200àM of dNTPs ;400ng of the purified total MCo DNA Cloning of the synthetic MCoTI-II The PCR...
- 9
- 497
- 0
Tài liệu Báo cáo Y học: Importance of the amino-acid composition of the shutter region of plasminogen activator inhibitor-1 for its transitions to latent and substrate forms pdf
... left the conformation of the shutter region Second, the rate of strand insertion during latency transition may be affected not only through a change in the conformation of the active form, but ... that of 63% of serpins [3], has the shortest half-life of all variants tested here, and in fact one of the shortest half-lives reported for a PAI-1 variant Thus, the reason for the tendency of ... K.W (1999) Engineering of conformations of plasminogen activator inhibitor1 A crucial role of b-strand 5A residues in the transition of active form to latent and substrate forms Eur J Biochem 263,...
- 10
- 431
- 0
ADVANCED VIDEO CODING FOR NEXTGENERATION MULTIMEDIA SERVICES doc
... Lattice Vector Quantizer for H 264/AVC and Motion JPEG2000 21 Ehsan Akhtarkavan and M F M Salleh Chapter Region of Interest Coding for Aerial Video Sequences Using Landscape Models 51 Holger Meuel, ... advances in the state -of- the-art video coding techniques, such as lossless high efficiency video coding (HEVC), multiple description video coding, region of interest video coding, and shape compensation ... efficiency video coding (HEVC), multiple description coding, region of interest (ROI) coding, shape compensation, error resilient algorithms for H.264/AVC, wavelet-based coding, facial video coding, ...
- 210
- 351
- 1
Báo cáo khoa học: The 3¢-UTR of the mRNA coding for the major protein kinase C substrate MARCKS contains a novel CU-rich element interacting with the mRNA stabilizing factors HuD and HuR ppt
... consisting of luciferase coding sequence (CDS) and MARCKS 3¢-UTR were driven by a CMV-promoter and used for transfection of Swiss 3T3 fibroblasts Length of the MARCKS 3¢-UTR sequences [38] of pDK1: ... expression of HuD and HuR For transient expression of HuD and HuR in Swiss 3T3 cultures, we employed the plasmids pTetoff and pTRE (expression vector with the tTA-regulated promoter) of the TetoffTM ... sequence The construction of 3¢ deletions of pDK1 was performed as described for pBS-DC1 deletion clones (see Preparation of RNA transcripts) except with digestion of pDK1 by ApaI and XhoI The...
- 16
- 754
- 0
The challenge of obesity in the WHO European Region and the strategies for response pptx
... publications of the WHO Regional Office for Europe to: Publications WHO Regional Office for Europe Scherfigsvej DK-2100 Copenhagen Ø, Denmark Alternatively, complete an online request form for documentation, ... WHO Regional Office for Europe is one of six regional offices throughout the world, each with its own programme geared to the particular health problems of the countries it serves The European Region ... WHO Regional Office for Europe), Eva Jané-Llopis (Mental Health Promotion and Medical Disorder Prevention, WHO Regional Office for Europe) and Matthijs Muijen (Mental Health, WHO Regional Office...
- 76
- 485
- 0
Advanced Video Coding for Next-Generation Multimedia Services pot
... Chapter Region of Interest Coding for Aerial Video Sequences Using Landscape Models 51 Holger Meuel, Julia Schmidt, Marco Munderloh and Jörn Ostermann Chapter Compensation Methods for Video Coding ... advances in the state -of- the-art video coding techniques, such as lossless high efficiency video coding (HEVC), multiple description video coding, region of interest video coding, and shape compensation ... efficiency video coding (HEVC), multiple description coding, region of interest (ROI) coding, shape compensation, error resilient algorithms for H.264/AVC, wavelet-based coding, facial video coding, ...
- 210
- 462
- 0
Báo cáo " Toward building 3D model of Vietnam National University, Hanoi (VNU) from video sequences " doc
... coefficient matrix For the assumed values the corresponding entries of a row of A are of the following magnitude r(−10, −10, −10, −1, 0, 0, 0, 0, 103, 103, 103, 102) The entries of ATA are approximated ... the magnitudes of homogeneous coordinates, the scaling transformation should reduce the average distance of feature points to their centroid For simplicity we use the following transformation to ... Bui / VNU Journal of Science, Mathematics - Physics 23 (2007) 210-220 Fig Log10 of condition number vs number of correspondences Fig Log10 of reprojection number vs number of correspondences...
- 11
- 371
- 0
SCOP: A Structural Classification of Proteins Database for the Investigation of Sequences and Structures ppt
... 1994 of the Brookhaven Protein Databank (PDB) contain 3179 domains Many of these become forms of the same protein whose differences are not significant in terms of the classification used here; for ... Most of the folds are assigned to one of the five structural classes on the basis of the secondary structures of which they composed: (1) all alpha (for proteins whose structure is essentially formed ... and turn regions that differ in size and conformation and, in the more divergent cases, these differing regions may form half or more of each structure For proteins placed together in the same fold...
- 5
- 546
- 0
Báo cáo khoa học: Complex alternative splicing of the hKLK3 gene coding for the tumor marker PSA (prostate-specific-antigen) ppt
... at 94 °C for min; cycles of denaturation at 94 °C for 30 s, annealing and elongation at 72 °C for 3.30 min; cycles of denaturation at 94 °C for 30 s, annealing and elongation at 70 °C for 3.30 ... instructions PCR was performed using specific primers (Table 1) with the following cycling conditions: 94 °C for and 35 cycles at 94 °C for 30 s, 68 °C or 55 °C for 30 s and 72 °C for 75 s The products ... steps of spliceosome assembly involve recognition of consensus elements at both ends of the intron Although these sequences are usually short, they are often degenerate Nevertheless, about 99% of...
- 9
- 349
- 0
Fixed Deposit Accounts: Accounts that give you a fixed rate of interest for a defined term. potx
... what the interest would be if interest was paid and compounded each year Our AER calculation assumes that the account is held for a year and that the interest rate remains constant Deposit Interest ... is the daily interest accrual rate permanent tsb p.l.c is regulated by the Central Bank of Ireland Publication date: 01/10/2012 BMK2328(3) (Rev 10/12) Variable Interest Rates for Former Irish ... Central Bank of Ireland Publication date: 18/09/2012 BMK2328(7) (Rev 09/12) Variable Interest Rates for Former Northern Rock Ireland Deposit Accounts These rates are effective from the start of business...
- 5
- 433
- 0
Báo cáo khoa học: Abortive translation caused by peptidyl-tRNA drop-off at NGG codons in the early coding region of mRNA potx
... translation due to drop-off at NGG codons To test for excessive drop-off of peptidyl-tRNA at certain early codons (including the NGG codons) they were placed in the 5¢ -coding region of a lacZ reporter ... 37.5 °C because of accumulation of peptidyl-tRNA, thus possibly causing decreased turnover and starvation for the tRNA moiety [22] One would therefore expect that overexpression of the corresponding ... reason for the observed low gene expression The length of the peptidyl moiety of the peptidyltRNA influences the drop-off process in the case of very small mini-genes [16,33] Overexpression of 5312...
- 11
- 510
- 0
Báo cáo Y học: The C-terminal region of ammodytoxins is important but not sufficient for neurotoxicity pot
... Pierce (Rockford, IL) All other chemicals were of analytical grade Construction of expression vectors The coding sequences for both AtnI2/AtxA(K108N) chimeric proteins were prepared by PCR using Vent ... BamHI/BstBI fragment (coding for N1–F106 of AtnI2) was excised from this cloning vector and inserted, together with the BstBI/HindIII fragment (coding for Arg107–Cys133 of the mutant AtxA(K108N) ... bandwidth of nm, a stepsize of nm, and an averaging time of s were used Protein concentrations were 15.2 lM for AtnI2/ AtxA(K108N), 16.5 lM for AtnI2(N24F)/AtxA(K108N) and 33.3 lM for wild-type...
- 6
- 344
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008