reducing the internal power demand of a power plant
OPTIMAL placement of FACTS devices by genetic algorithm for the increased load ability of a power system
... flow, thereby increasing the Active Power flow capacity Again it is found that UPFC is the most powerful and versatile FACTS device due the fact that line impedance, voltage magnitude and phase angle ... cycle and individuals of same population with improved characters are created in the next generation The objective function is then again calculated for all the individual of the new generation and ... FACTS devices both the active and reactive power flow pattern can be changed and significant system performance is noticed The optimal allocation of FACTS Devices can be formulated as: CTOTAL=C1(E)+C2(F)...
- 6
- 541
- 0
Thermoeconomic optimization of the steam power plant
... cost of the product Results and discussion The first and second law analysis of thermodynamics is applied to the examined steam power plant According to the results of the first law analysis, the ... (5) The design parameters for first and second law analysis of the system can be seen in Table The system design parameters have been defined by analyzing the common thermal power plant applications ... belonging to the system elements that compose steam thermal power plant is given in Ref [11] Table The design parameters to be used in the first and second law analysis Parameter Power of steam plant...
- 8
- 384
- 0
MÔ HÌNH MÔ PHỎNG CỦA NHÀ MÁY THỦY ĐIỆN SHKOPETI. (SIMULATION MODEL OF THE HYDRO POWER PLANT SHKOPETI)
... ph a Bắc Albania Bảng 1: Nhà máy thủy điện An-ba-ni Trang MÔ HÌNH H A VÀ MÔ PHỎNG GVHD: PGS.TS QUYỀN HUY ÁNH Những nhà máy thủy điện đóng vai trò chủ đạo mô hình động hệ thống điện An-ba-ni Sau ... Macedonia [7] Hình 1: Albania với nhà máy điện Shkopeti Trang MÔ HÌNH H A VÀ MÔ PHỎNG GVHD: PGS.TS QUYỀN HUY ÁNH Nhà máy thủy điện Shkopeti Các nhà máy thủy điện Shkopeti nằm ph a Bắc Albania ... Nam Đông Âu hỗ trợ ban trao đổi hàn lâm Đức Vấn đề ngành điện An-ba-ni hạn chế khả phát điện [1] Albania phải nhập 25% tổng số điện Sự gia tăng mức tiêu thụ điện, đặc biệt hộ gia đình (nấu ăn, làm...
- 17
- 867
- 0
The Design and Implementation of a Log-Structured File System
... purpose The separate data area of these database systems means that they not need the segment cleaning mechanisms of the Sprite LFS to reclaim log space The space occupied by the log in a database ... log as the most up to date ‘‘truth’’ about the state of the data on disk The main difference is that database systems not use the log as the final repository for data: a separate data area is reserved ... modeled The simulator runs until all clean segments are exhausted, then simulates the actions of a cleaner until a threshold number of clean segments is available again In each run the simulator was...
- 15
- 1,434
- 0
reducing the degree or intensity of, or eliminating, pollution
... The dry forms are acidic gases or particulates Acid Mine Drainage: Drainage of water from areas that have been mined for coal or other mineral ores The water has a low pH because of its contact ... damage of all friable asbestos containing materials and thermal insulation systems Asbestos Program Manager: A building owner or designated representative who supervises all aspects of the facility ... ro Aerated Lagoon: A holding and/or treatment pond that speeds up the natural process of biological decomposition of organic waste by stimulating the growth and activity of bacteria that degrade...
- 217
- 423
- 0
Optimization of design and operating parameters on the year round performance of a multi-stage evacuated solar desalination system using transient mathematical analysis
... performance and thermal characteristics of the system Description of the multi-stage evacuated solar desalination system The Multi-stage evacuated solar desalination system is a combination of evaporative-condenser ... is refined latent heat of vaporization of water at the condenser surface of last stage (J/kg), h fgNs is latent heat of vaporization of water at the condenser surface of the last stage (J/kg), ... condensation The outlet temperature from the flat plate collectors, latent heat and refined latent heat of vaporization of water from each stage and specific heat capacity of water from each stage are averaged...
- 26
- 568
- 0
the meaning and structure of a narrative a systemic functional analysis
... for the syntactic structure of language, it prefers placing the function of language as central (what language does and how language does it) rather than placing the elements of language and their ... Re-examine some of the most important issues related to the experiential aspect of functional grammar Analyze the meaning and structure of a narrative based on the systemic functional analysis ... grammar are different from formal models of grammar by their focus on the communicative aspect of language 2.4 Metafunctions Halliday developed a theory of the fundamental functions of language...
- 39
- 826
- 2
Tài liệu Báo cáo " The meaning and structure of a science fiction story: a sysyemic functional analysis " doc
... declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative ... Subject The spaceship The planet They There The spaceship The two astronauts The woman It She We It Both of them They All plants and Animals They They Everything The man Nothing Something He I The ... declarative declarative declarative declarative declarative declarative declarative declarative imperative declarative declarative Modality ability/neg ability/pos ability/neg ability/neg ability/neg...
- 18
- 712
- 4
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc
... CTGAGGTTACAGACAACTGTTC CCTTTGACATCGCAAGTGGATCA TTGAGGTGACAGACAATTGCCT TCTTTGACTTCTCAAACTGATCG GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC RPE65c-His-Fwd ... GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC GATATCTTATGGTTTGTACATCCCATGGAAAG GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC AAGCTTCTAAGGTTTGTAGATGCCGTGGAG TGGGGAGGACTTTTATGCTGT CTTTTGTGTAGGTGGGATTCG CTGAGGTTACAGACAACTGTTC ... iron-dependent Characterization of the kinetic parameters of the enzymatic activity of zebrafish RPE65c To determine the steady-state kinetics of the enzymatic activity of zebrafish RPE65c, the assay conditions...
- 14
- 753
- 0
Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc
... neutral and alkaline pH; PhyH-DII was less stable under the same conditions (Fig 2D) PhyH was basically stable at 35 °C, and retained 60% of the initial activity at 45 °C for 90 when assayed at ... another single-domain phytase may improve the catalytic efficiency of the latter Materials and methods Strains, plasmids and chemicals E coli Trans1-T1 (TransGen, Beijing, China) and pGEM-T Easy ... sum of PhyH-DI and PhyH-DII and two times greater than that of PhyHDII This large variance cannot be ascribed to the function of PhyH-DI alone The dual-domain phytase was shown to be a dimer according...
- 9
- 801
- 0
Tài liệu Linking the Gaza Strip with the West Bank: Implications of a Palestinian Corridor Across Israel docx
... Pakistan This demand was the immediate cause The fifth and final cause of the war was the impact of a major hurricane that affected East Pakistan The apathy of the West Pakistani leadership and their ... threat has been aggravated in recent years by the Palestinian Authority’s loss of control, in particular, over the Gaza Strip Waves of anarchy, chaos, and lawlessness have overtaken the area, and ... down the of ces of the pan-Arab Al have by facilitating the spread of Gaza’s lawlessness into the West Bank and ultimately to Israel Masked Fatah gunmen have occupied various PA fence, since large...
- 64
- 307
- 0
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx
... oxyheme appeared at 540 and 579 nm Then, a broad band appeared at around 660 nm, and was maximal 9–12 after initiation of the reaction The spectral features of the final reaction mixture were analogous, ... band so that it almost vanished after 30 min, and instead, an absorption peak appeared at 637 nm, suggesting the formation of CO–verdoheme The 637 nm band disappeared gradually and was replaced ... absorption bands Heme catabolism by HOs of mammals, pathogenic bacteria, cyanobacteria and probably insects is considered to have a similar mechanism, because the characteristic absorption bands of verdoheme...
- 16
- 617
- 0
Tài liệu Báo cáo khoa học: Structure and membrane interaction of the internal fusion peptide of avian sarcoma leukosis virus pdf
... nm at a scanning rate of 50 nmÆmin)1 with a time constant of s, step resolution of 0.1 nm, and bandwidth of nm The final spectra were taken from the average of five scans The VARSELEC program was ... deeply into the apolar core of the membrane Our data are also compatible with the observation that truncation of the membrane-spanning region of HA2 to the extent that the resulting segment cannot ... cross-peaks attributed to bH of Ala12 and NH of Val15, and aH of Pro13 and NH of Val15 Ó FEBS 2004 Structural study of internal fusion peptide of ASLV (Eur J Biochem 271) 4733 Conformational alteration...
- 12
- 589
- 0
Tài liệu Báo cáo khoa học: Binding of ligands originates small perturbations on the microscopic thermodynamic properties of a multicentre redox protein pptx
... optimization The half-height widths of the NMR signals were used as a measure of the uncertainty of each NMR data point and an experimental uncertainty of 2% was assumed for the experimental points of the ... because these are the most distant pair of haems in the structure and are therefore expected to have the weakest interaction [33] The pH dependence of the chemical shifts of the NMR signals of the ... that the spectra are very similar with respect to chemical shifts of the signals in intermediate stages of oxidation, and that formation of the complex does not lead to a marked decrease of the...
- 10
- 640
- 0
Tài liệu The Design and Performance of a Real-time CORBA Event Service doc
... data was not availHigh Level able to be pulled, the calling I/O Facade would need to block I/O Facade I/O Facade I/O Facade Abstraction awaiting a result In order for the I/O Facade to pull, the ... system must allocate additional threads to allow the application to make progress while the I/O Facade task is blocked However, 2: Demarshaled data adding threads to the system has many negative consequences, ... guaranteed that its deadline will be met, based on the published parameters of each schedulable operation One advantage of our approach is that operation invocations only pay the overhead of the C++...
- 20
- 737
- 0
Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf
... state B, active state above pH 6.3 side-chain at residue 210 is dispensable, as shown by the fact that H21 0A and H210S are as active as native API with VLK-MCA as a substrate (Table 1) This means ... by the Trp169–His210 stacking, suggesting that API has a catalytic quadruple apparatus, composed of Ser194, His57, Asp113 and His210, rather than a catalytic triad ACKNOWLEDGEMENT We are grateful ... aspartate in the catalytic triad is not fully understood because several serine proteases not have an aspartate as the catalytic apparatus M NaCl However, for chymotrypsin-type serine proteases,...
- 7
- 603
- 0
Đề tài " Numerical characterization of the K¨ahler cone of a compact K¨ahler manifold " doc
... Annals of Mathematics, 159 (2004), 1247–1274 Numerical characterization of the K¨hler cone of a compact K¨hler manifold a a By Jean-Pierre Demailly and Mihai Paun Abstract The goal of this ... there exists a very neat characterization of nef classes on arbitrary surfaces, K¨hler or not a The Main Theorem has an important application to the deformation theory of compact K¨hler manifolds, ... can also view this fact as a characterization of the dual cone of the nef cone, in the space of real cohomology classes of type (n − 1, n − 1) This leads immediately to Corollary 0.4 In the case...
- 29
- 468
- 0
Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt
... that factor Xa cleaved and activated proHP8Xa When activated HP8Xa was mixed with proSpatzle¨ 1A, the 38 kDa pro-Spatzle band disappeared, and a ¨ 12 kDa product was produced (Fig 7A) N-terminal ... analysis using antiserum against M sexta HP8 Bands representing the proHP8Xa zymogen, a truncated form of proHP8Xa and the catalytic domain of active HP8 are marked with arrowheads The size and ... cDNA or : 25 for fat body cDNA) was used as template for quantitative RT-PCR analysis The M sexta ribosomal protein S3 (rpS3) mRNA was used as an internal standard to normalize the amount of RNA...
- 15
- 540
- 0
Understanding the Insider Threat - Proceedings of a March 2004 Workshop potx
... Another insider installs a keystroke logger to get a few passwords to another computer in the same office • A database administrator makes an extra copy of the database files, but says the tapes ... Breakout sessions considered what databases would aid in this research if they were available Researchers need databases containing examples of specific attacks, the characterization of normal ... for the development of such datasets include a MITRE dataset of normal, and “insider threat” network activities; data from the ARDA NIMD4 study; data obtained from use of the Glass Box5 software;...
- 137
- 344
- 0
Báo cáo khoa học: Val216 decides the substrate specificity of a-glucosidase in Saccharomyces cerevisiae doc
... II of maltase is the catalytic nucleophile Because the Asp214 of maltase is equivalent to the Asp215 of isomaltase, a mutant with the residue altered to Ala was tested for its activity on a- pNPG ... YGR287c The sequence data for isomaltase is available from the DNA Data Bank of Japan with accession number AB109221 The entire coding region of the insert was amplified by PCR and subcloned into the ... Mun/Bpu and Mun/Bst were about 10 and 80 times lower than that of isomaltase, respectively The Km for a- pNPG of Mun/Bpu was the same as that of isomaltase, whereas the Km for a- pNPG of Mun/Bst was about...
- 7
- 452
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng 9 tr 25