... concordancer Then, the returned spotted translation equivalents are evaluated against a manually annotated gold standard in terms of recall and precision metrics We also build two different translation ... correlation inherits the characteristics of normalized frequency and is adjusted for spotting rare translations These characteristics are especially important fora domain -specific bilingual concordancer ... function and evaluated against the reference translation set We also compared the ranking performance with the Dice coefficient 3.2 Evaluation of Translation Spotting We evaluate the translation...
... was the 2001–2002 AAHPERD Alliance Scholar, a fellow in the American Academy of Kinesiology and has received the NASPE Hall of Fame award, the NAGWS Honor Award, the R Tait McKenzie Award, and ... research-based articles, which have appeared in noted academic journals He has served as a sport psychology consultant for athletes and teams competing at national and international level for ... children, athletes and families in a variety of capacities He spent several years as a high school teacher and coach before serving as a counselor for ungovernable children and their families He has also...
... privacy laws for USA, Australia, Canada, United Kingdom, India, and the European Union 2.1.1 United States of America (USA) There are several federal and state laws that have provisions for data ... discloses and manages acustomer or client's data." So, a privacy policy is a legal statement that tells the user how a company or website operator may use, gather, manage or share the personal data ... covered by the Act For example, the privacy policy of Shop A Docket, an Australian website for deals and coupons, specifies that they make an effort to handle personal information in accordance with...
... most auto finance transactions is publicly available would make it less likely that particular data could be tied to an individual transaction B BAN ARBITRATION CLAUSES IN AUTO SALES AND FINANCE ... for all claims against the dealer Many bond amounts have not been adjusted for inflation for decades This issue has become especially important in recent years The National Automobile Dealers Association ... Disparity, and Class Action Litigation.” available at http://ssrn.com/abstract=951827 B EXISTING PROTECTIONS There are many federal and state laws that apply to car sales Yet these laws leave huge gaps...
... 101:6062-6067 Goh KJ, Tan CT, Chew NK, Tan PS, Kamarulzaman A, Sarji SA, Wong KT, Abdullah BJ, Chua KB, Lam SK: Clinical features of Nipah virus encephalitis among pig farmers in Malaysia N Engl J Med ... PBS) and fixed with 2% paraformaldehyde Cells were then acquired using FACS-Diva software on a FACS Aria machine (BD Biosciences, San Diego, CA) with excitation at 407 nm and emission at 520 nm and ... Wiltshire T, Batalov S, Lapp H, Ching KA, Block D, Zhang J, Soden R, Hayakawa M, Kreiman G, et al.: A gene atlas of the mouse and human protein-encoding transcriptomes Proc Natl Acad Sci USA 2004,...
... country’s healthcare system Policymakers have a dual challenge ahead: to ensure high standards of care for ageing populations, while also maintaining the financial sustainability of state health and ... old age This is not to say that the European healthcare professionals we surveyed not believe that policymakers are already addressing demographic shift Around 40% say that national healthcare policy ... healthcare 67 Administration 11 Healthcare, pharma or biotech research Strategy and policy making Healthcare, pharma or biotech manufacturing Member of an NGO, lobbying organisation or healthcare...
... ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC Table Yeast ... membrane was from Millipore (Bedford, MA, USA) Goat polyclonal anti-(yeast Vps4p) IgG was from Santa Cruz Biotechnology (Santa Cruz, CA, USA) and rabbit polyclonal anti-(carboxypeptidase Y) and anti-calmodulin ... the AAA superfamily typically contain one or two ATPase domains that assemble into one or two stacked hexameric rings The ATPase catalytic site is located at the interface between adjacent ATPase...
... conglomerate marble back panels cannot be fixed to the wall on a permanent basis Instead they should be stood vertically against the wall and held in place by the appropriate timber mantel If you have ... flue A gas fire requires a brick chimney, pre-cast flue or a pre-fabricated flue Where there is no flue and the fire is to be installed on an outside wall, you can installa balanced-flue gas fire ... cleaner must be non-abrasive A loose tile can be refixed with heat-resistant ceramic tile cement Marble: Polished stone surfaces can be washed with soapy water, dried with a chamois leather and...
... impose a uniform global standard comparable to that for ships, or even a minimum standard comparable to that for dumping at sea Indeed, no such global standards exist for land-based or airborne ... (1984) ASMA Antarctic Specially Managed Area ASOC Antarctic and Southern Ocean Coalition ASPA Antarctic Specially Protected Area ASPPR (Canadian) Arctic Shipping Pollution Prevention Regulations ... the manuscript; Kari Lorentzen, for invaluable bibliographical assistance; Claes Ragner Lykke, for cartographic assistance; Maryanne Rygg and Ivar Liseter, for various formatting assistance; and...
... write may be associated with evidence of having learnt the language Writing is tangible parents and students can see what hasbeen done and what hasbeen achieved So it has high ‘face validity’ ... The Grammar- Syntax- Organization Approach The name ‘the Grammar- Syntax- Organization Approach’ fully reveals the characteristics of the approach Writing cannot be seen as composed of separate ... In details, teacher plays roles as an organizer, an advisor, a consultant, an elicitor, a participant, a negotiator, a facilitator, an initiator and a knowledge resource Students’ roles are not...
... is a way to gradually establish a new balance between old physical capital, the investment of the past, and natural resources Thus, a successful strategy for sustainable development has to be an ... biomass or wind-power, and substantially lower than for solar energy The vast amounts of fossil fuels available on earth is an advantage compared to the biomass and wind-power alternatives that ... points Natural gas has great potential as a motor fuel It is cheap, hasa high octane number, is clean and has no problem in meeting existing and future emission standards However, methane is a powerful...
... states (such as California) and cities (such as Chicago and Seattle) have or are initiating their own global warming gas emission reduction programs.6 State and city-level policy incentives and ... marketing is making a comeback.5 The need for sustainability has become more acute economically as soaring demand, dwindling supplies, and rising prices for oil, gas, coal, water, and other natural ... several reasons for the Prius’ market demand Initially, the buzz over the Prius got a boost at the 2003 Academy Awards when celebrities such as Cameron Diaz, Harrison Ford, Susan Sarandon, and...
... non-Canadians canvassed who agreed with that assessment was even smaller, at 6% However, 33% of Canadian respondents and 32% of non-Canadian respondents did acknowledge that Canada was better than ... Costa Rica, including elevating its global standing as a worthy site for foreign investment Canada, of course, has many more inbuilt attractions for investors than Costa Rica, yet it also appreciates ... targets of both Canadian and non‑Canadian executives The continuing case for investing in Canada Some developed markets are notably better than others at attracting foreign investors That has...
... paradoxical: regulatory standards have been predicated on credit ratings, but there hasbeen little direct oversight of how the ratings are made (box 1) Traditionally, market discipline hasbeen ... rating agencies and made credit ratings essential for issuers and the cornerstone of regulations across a range of financial sectors As a result, rating agencies now play a critical role as de facto ... debt market a major catalyst for the global financial crisis But many of the complaints about them are not new Failures of ratings on structured securities Credit rating agencies played a pivotal...
... tax assets Three countries with large international banking systems are either using a leverage ratio or have announced plans to so The United States and Canada have maintained a leverage ratio ... tax assets Three countries with large international banking systems are either using a leverage ratio or have announced plans to so The United States and Canada have maintained a leverage ratio ... tax assets Three countries with large international banking systems are either using a leverage ratio or have announced plans to so The United States and Canada have maintained a leverage ratio...
... www.hsrcpublishers.ac.za Free download from www.hsrcpublishers.ac.za Free download from www.hsrcpublishers.ac.za Free download from www.hsrcpublishers.ac.za Free download from www.hsrcpublishers.ac.za Free ... www.hsrcpublishers.ac.za Free download from www.hsrcpublishers.ac.za Free download from www.hsrcpublishers.ac.za Free download from www.hsrcpublishers.ac.za Free download from www.hsrcpublishers.ac.za Free ... www.hsrcpublishers.ac.za Free download from www.hsrcpublishers.ac.za Free download from www.hsrcpublishers.ac.za Free download from www.hsrcpublishers.ac.za Free download from www.hsrcpublishers.ac.za Free...
... Canada MON-Ø4Ø32-6 (GTS 40- Monsanto 3-2) Canada, Japan, USA Australia (food), Canada, USA Australia (food), Canada, Japan, Korea, USA Australia (food), Canada, Japan, USA Australia (food), Canada, ... Korea, USA Canada, Japan, USA China, Mexico, Philippines Australia (food), Canada, EU, Japan, Korea, USA Australia, Canada, EU, Japan, Korea, USA China, Mexico, South Africa China, South Africa Aventis ... Nigeria, Netherlands, North Korea, Panama, Pakistan, Paraguay, Peru , Romania, Russia, Saudi Arabia, Slovenia, South Korea, Sri Lanka, Sudan, Swaziland, Syria, Tanzania, Thailand, Turkey, Uganda,...
... Terms A patient whohas never had treatment for TB or whohas taken antituberculosis drugs for less than one month Relapse A patient previously treated for tuberculosis whohasbeen declared cured ... maintenance phase (HR) If smear positive, continue the maintenance phase (HR) anyway If smear positive, start the maintenance phase (HR) anyway If smear negative, continue the maintenance phase ... occasions for smear positive case – at the end of the Intensive Phase, in the middle of the Maintenance Phase, and at the end of the Maintenance Phase.) Treatment Completed: A patient who has...
... pairs as testing data We also select 400 pairs to be manually annotated as held-out set (development set) to adjust parameters The remained 5,046 pairs are used as domain -specific training data ... this paper are different from those in (Wu and Wang, 2004) The training data and the testing data described in (Wu and Wang, 2004) are from a single manual The data in our corpus are from several ... paper proposes an approach to improve domain -specific word alignment through alignment model adaptation Our approach first trains two alignment models with a large-scale out-of-domain corpus and...