rearrangement of genes encoding antigen receptors
Báo cáo khoa học: "PCR-based detection of genes encoding virulence determinants in Staphylococcus aureus from bovine subclinical mastitis cases" doc
... :drawrof CGAAATCAAGCAGTTCCGAACGCA :esrever TTGGCATAGTGGTAGTTAGC :drawrof TACAGCAATTTGGACCAC :esrever AAGGAGAAAACCACGAAC :drawrof CTCCTTCTGTTGTTGTTCGG :esrever GCGTCGTAAACGTCGTCCAC :drawrof CGTAGCTTGTTAGCCTTCG ... detatipicerp saw AND )1 : 42( lohocla lymaosi :mroforolhc dna )1 : 1( mroforolhc :lonehp htiw noitcartxe yb deifirup saw AND Co56 ta nim 03 rof detabucni dna )lCaN M 7.0 ni edimorb muinomma lyhtemirt ... GCGTCGTAAACGTCGTCCAC :drawrof CGTAGCTTGTTAGCCTTCG :esrever GGACATGGTCGTAGAGATA :drawrof CGAAT ATAACTGGGACTTTT :esrever GGATGTTCGTGACTTCGG :drawrof )'3-'5( ecneuqeS aps aps A tne cun )noiger-X( aps )gnidnib-GgI(...
- 4
- 138
- 0
Báo cáo khoa học: "Phylogenetic characterization of genes encoding for glycoprotein 5 and membrane protein of PRRSV isolate HH08" docx
... reports of ORFs and indicated that both were composed of 603 and 525 nucleotides (nt), respectively The lengths of both ORFs differed between NA and EU types; for example, the lengths of ORFs and of ... and 522 nt, respectively The lengths of both ORFs of most NA-types of PRRSVs are 603 and 525 nt, respectively The sequence comparison showed that the ORF5 gene of PRRSV HH08 had 88.9∼99.2% and 87.4∼98.5% ... geographic locations in China The outbreak of PRRS often causes enormous economic losses in the pig-producing industry Analysis of PRRSV origin and evolution is one of the important references for effective...
- 7
- 384
- 0
Báo cáo khoa học: Cloning and characterization of the genes encoding toxic lectins in mistletoe (Viscum album L) pot
... that encodes an isoform of the protein encoded by ml3p Cloning of the sequences of mlp genes Activity of recombinant A-chains in reticulocyte lysate The biological activity of the recombinant ... The product of the second round of PCR was cloned and the 1066 bp sequence encoding 125 amino acids of the A-chain, the 19 amino acids linker, and 216 amino acids of the B-chain of the ml gene ... (length of 415/430 bp) and competitor fragment (length of 388 bp) were excised Radioactivity of the bands was then measured as for the assessment of the quantitative ratio of the three variants of...
- 11
- 610
- 0
Báo cáo y học: " Asthma and genes encoding components of the vitamin D pathway" potx
... candidate genes were chosen for this study Figure is a cartoon of the vitamin D pathway that illustrates the implication of each gene selected Briefly, genes encoding key components of the vitamin ... inherent complexity of the disease as well as methodological issues related to finding genes of complex diseases [3] The emerging picture from the literature suggests hundreds of genes are associated ... promoter region of IL10 and the 3'UTR region of VDR However, more complex interactions between these two genes were observed between SNPs located in the 3'UTR region of both genes Figure 5c shows...
- 21
- 373
- 0
Báo cáo y học: "Meta-analysis of primary target genes of peroxisome proliferator-activated receptors" pdf
... strength of 75 ± 15% of that of the consensus PPRE; sequences in class II are bound with a strength of 45 ± 15% of that of the consensus PPRE; and sequences in class III are bound with a strength of ... regions of the genes APOA1, PPARα and UCP3 and on the distal regions of the genes ANGPTL4 and UCP3 In contrast, no statistically significant binding of pPol II, irrespective of the presence of ligand, ... content of target genes Based on the different comparisons, we chose the PPRE classifier as most suited for the follow-up analysis of PPAR target genes In silico analysis of known PPAR target genes...
- 29
- 529
- 0
Báo cáo y học: "The transferome of metabolic genes explored: analysis of the horizontal transfer of enzyme encoding genes in unicellular eukaryotes" docx
... annotation program based on enzyme sequence profile searches The enzyme profiles are based upon alignment of the amino acid sequences of conserved regions of genes of known function (EC number) These are ... shows the overall levels of high-confidence E/HGT events in each species group, while a detailed listing of enzymes Figure The predicted extent of the transfer of genes encoding metabolic enzymes ... the analysis of more detailed functional properties of the transferred genes that encode them, such as network connectivity To investigate the extent of the horizontal transfer of genes that encode...
- 13
- 163
- 0
Báo cáo y học: "Functional genomics analysis of low concentration of ethanol in human hepatocellular carcinoma (HepG2) cells. Role of genes involved in transcriptional and translational processes"
... concentrations of ethanol (100 mM) induced the expression of genes involved in the metabolism of ethanol [16] In addition, the metabolism of ethanol 33 results in an increased production of toxic metabolites ... Pathway Architect software (Stratagene) Figure 3A shows the reported interactions of each of these genes ITGB4 and ANK3 are associated with different targets, including small molecules, genes and proteins ... the findings of the microarray analysis on gene expression in response to ethanol Figure Validation of ethanol-regulated genes by real time RT-PCR mRNA levels of ethanol-regulated genes determined...
- 8
- 702
- 0
Tài liệu Báo cáo khoa học: Constitutive oligomerization of human D2 dopamine receptors expressed in Spodoptera frugiperda 9 (Sf9 ) and in HEK293 cells Analysis using co-immunoprecipitation and time-resolved fluorescence resonance energy transfer pdf
... hetero-oligomerization of D2L and D2S is of particular interest as it may affect the function of the two isoforms of the receptors, with possible direct consequences on the effect of antipsychotic ... probably reflects a difference in the number of receptors used In fact, we used 100 fmol of receptors in the membranes, which is probably higher than the number of receptors present on 500 000 cells Despite ... observation of signal Membranes containing the equivalent of 100 fmol of receptors (as labelled with [3H]spiperone) were incubated with 2.5 nM Eu3+-labelled anti-FLAG Ig, in a total volume of 500 lL of...
- 11
- 618
- 0
Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf
... additional genes encoding other proteins implicated in the biosynthesis of the aminonucleoside moiety of A201A Here we report the sequencing of a total of 6946 bp, which include the ata genes most ... include a number of genes of its biosynthetic (ata) gene cluster Downstream of ard1 there seems to be one end of this cluster (Fig 2) Indeed, this region contains a sequence of 719 residues with ... continuous stretch of DNA of approximately 50 kb, which might include most of Ó FEBS 2002 the ata cluster In this respect, upstream of the ard1 resistance gene we detected seven complete ORFs Of these,...
- 9
- 728
- 0
Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identification of a novel subtype of thyrotropin-releasing hormone receptor ppt
... desensitization of the responses (Lower) Responses of the three xTRHR subtypes to different concentrations of TRH The maximum current amplitude of each recording was measured and reported as a function of ... Amplification of cDNA templates with a set of primers corresponding to the Xenopus EF1a elongation factor cDNA (280 bp) as internal control of the poly(A) + RNA (C) Tissue comparison of the level of expression ... proteincoupled receptors are clearly TRH receptors An important finding of this study is the description of a novel TRH receptor subtype that does not belong to the subtypes and of TRHR This xTRHR3...
- 11
- 506
- 0
Tài liệu Báo cáo Y học: A pool of Y2 neuropeptide Y receptors activated by modifiers of membrane sulfhydryl or cholesterol balance pot
... at 37 °C) of monolayers with PAO in the range of 3–100 lM, and pretreatment or cotreatment of particulates with 30 lM of the arsenical Competition by nonlabeled hPYY(3–36) showed Kd of 442 ± 37 ... presence of the indicated concentrations of NEM, MTSET or DTT The separation of surface and internalized tracer was done as in Figs and In the same set of experiments (n ¼ 3), the surface binding of ... induce a Masked Y2 NPY receptors (Eur J Biochem 269) 2319 Fig Comparative dynamics of labeling of Y2 sites in gpY2-CHO cells and of Y1 sites in gpY1-CHO cells in the presence of phenylarsine oxide...
- 8
- 469
- 1
Báo cáo khoa học: Two overlapping antiparallel genes encoding the iron regulator DmdR1 and the Adm proteins control sidephore and antibiotic biosynthesis in Streptomyces coelicolor A3(2) pdf
... regulator of desferrioxamine biosynthesis in the presence of iron Lack of DmdR1 or deprivation of iron leads to deregulated (constitutive) formation of desferrioxamines However, expression of adm ... mutations of their conserved sequences led to decreased expression of the region of the gene lying downstream of the reverse promoter This has been interpreted as a mechanism for tight control of expression ... antiparallel genes and iron regulation of Adm protein in this strain, i.e Adm may act as a negative regulator of antibiotic biosynthesis Expression of the adm gene is known to be under the control of the...
- 14
- 435
- 0
Báo cáo khoa học: Amino acid limitation regulates the expression of genes involved in several specific biological processes through GCN2-dependent and GCN2-independent pathways ppt
... on the expression of 12 genes and opposite effects on the regulation of eight genes These results suggest that rapamycin inhibition of TORC1 modifies the expression of a set of genes that only partially ... computed as the ratio of the distribution of the amino acid-regulated genes* versus the distribution of the genes spotted onto the microarray** *Percentage of the representation of one GO term among ... GCN2-independent regulation of gene expression Our results show that rapamycin, an inhibitor of mTORC1, regulates the expression of a set of genes almost as large as the set of genes regulated by amino...
- 12
- 560
- 0
Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt
... and because of the potential use of the toxins as biological weapons Alteration of their MHC and TCR binding capacity by site directed mutagenesis could be useful in the development of vaccines ... gradient Streptococcus pyogenes superantigen (SSA) The ssa-1 gene was PCR amplified from Streptococcus pyogenes DNA (ATCC 51500 strain) or clinical isolates of S pyogenes with 5¢ and 3¢ terminal ... binding of Vb1–SSA with Kd ¼ 10.82 lM (E) and Vb1–SSA(C26S) with a Kd ¼ 9.14 lM (F) Fig SSA dimer in supernatant of S pyogenes Supernatants of isolates from patients infected with S pyogenes were...
- 9
- 485
- 0
Báo cáo khoa học: Molecular cloning, expression and characterization of cDNA encoding cis-prenyltransferases from Hevea brasiliensis A key factor participating in natural rubber biosynthesis pdf
... IPTG; S2, supernatant of the homogenate of E coli BL21(DE3)/pETHRT2 with IPTG; PC, pellet of the homogenate of E coli BL21(DE3)/pET32b without IPTG; P1, pellet of the homogenate of E coli BL21(DE3)/pETHRT1 ... that of yeast dolichols (C80–C100; 1.1–1.3 kDa) GPC analysis of the rubber material synthesized by the action of purified HRT2 in the absence of WBP indicated the production of a small amount of ... Overexpression of HRT1 and HRT2 is shown in the left panel: M, molecular mass marker; SC, supernatant of the homogenate of E coli BL21(DE3)/pET32b without IPTG; S1, supernatant of the homogenate of E coli...
- 10
- 516
- 0
Báo cáo khoa học: Ligand-specific dose–response of heterologously expressed olfactory receptors potx
... processing in any of those transiently transfected cells Differential dose–response to a family of linear aldehydes for I7 In the case of I7, the response of the receptor to a family of linear aldehydes ... number of olfactory receptor genes and the large spectrum of odorants detected by a given receptor, this adds another level of complexity to the olfactory receptor world The combination of these ... and expression of odorant receptors Nature 361, 353–356 Wellerdieck, C., Oles, M., Pott, L., Korsching, S., Gisselmann, G & Hatt, H (1997) Functional expression of odorant receptors of the Zebrafish...
- 8
- 313
- 0
Báo cáo khoa học: Membrane distribution of epidermal growth factor receptors in cells expressing different gangliosides doc
... Glycolipid labelling of CHO-K1 cell clones A schematic representation of the pathway of glycolipid biosynthesis is shown at the top of the figure It is appreciable how the pathways of ganglioside synthesis ... cells of the enzyme involved in the synthesis of GM1 (Fig 1) [23] To reduce the content of all glycosphingolipid classes, wild-type CHO-K1 cells were treated with PPPP, a competitive inhibitor of ... glucosyltransferase and hence of the synthesis of complex glycolipids (Fig 1, CHOK1/PPPP) [24] Exposure of cells to lM PPPP in the culture medium for days led to a 95% decrease of GM3 content with respect...
- 10
- 327
- 0
Báo cáo khoa học: Methods to monitor the quaternary structure of G protein-coupled receptors doc
... too often the case, as an indication of ligand-promoted dimer formation or dissociation The occurrence of FRET between fluorophoretagged GPCRs could result both from the formation of dimers or of ... oligomerization of the partners is not promoted by the bivalent nature of the antibodies In studies assessing the effect of ligand-binding on the quaternary structure of the receptors, the possibility ... widespread use of coimmunoprecipitation following coexpression of two forms of the same GPCR in heterologous expression systems Initially Hebert et al [18] coexpressed c-myc- and HA-tagged forms of the...
- 12
- 337
- 0
Báo cáo Y học: Irregular spiking in free calcium concentration in single, human platelets Regulation by modulation of the inositol trisphosphate receptors ppt
... regardless of the type of agonist, stimulating (thrombin) or sensitizing (thimerosal) InsP3 receptors or acting primarily independently of InsP3 receptors (U73122), and regardless of the type of stores ... (r) (initial value of each trace, F/Fo ¼ 1) Insert shows expanded part of curves a–c (B) Selection of regions of interest of the platelets (areas 0.8 · 2.5 lm) (C) Histogram of variation in peak-to-peak ... described elsewhere [31] Immediately before start of a measurement, a sample of 0.4 mL was added to 1.6 mL of Hepes/KCl buffer pH 7.4 (buffer C), composed of 100 mM KCl, 100 mM sucrose, 20 mM Hepes,...
- 10
- 533
- 0
Báo cáo khoa học: Caenorhabditis elegans has two genes encoding functional D-aspartate oxidases pot
... animal tissues [28–30] In addition, the DAAO -encoding genes of yeasts [31–33], fungus [34], fishes [35], and mammals [36–42], and the DASPO -encoding genes of yeast [43] and mammals [44–46] have been ... each of the 138 DAAO and DASPO genes, one of the C elegans databases, WormBase (http://www.wormbase.org/), has annotated four different genes (Y69A2AR.5, C47A10.5, F18E3.7a, and F20H11.5 genes) ... sequence analysis of the C elegans genes encoding DAAO and DASPO cDNA fragments corresponding to the sequences of each ORF of Y69A2AR.5, C47A10.5, F18E3.7a, and F20H11.5 genes were cloned as described...
- 13
- 293
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008