reading data from a text file
Extracting ID3 Data From an MP3 File
Ngày tải lên :
07/11/2013, 15:15
... instance, we need to take the loaded XML data, place it into indexed positions of an array, and set that array as the data provider for the playlist_lb instance As a result, our loaded XML data appears ... tempArray, each with label and data properties representative of song names and song filenames, as just described The last action within the onLoad event handler sets tempArray as the data provider ... the data after loading it Let's look at this event handler in detail It's important to remember that the data loaded in from this XML file contains the name of each song, such as Agent 00, and...
- 12
- 246
- 0
Tài liệu Module 1: Displaying Data from a Database docx
Ngày tải lên :
11/12/2013, 14:15
... Displaying Data from a Database Database Architecture Slide Objective To provide an overview of database architecture Lead-in A database is a collection of data that you can sort, search, add ... to a database A site that enables users to search, retrieve, and update data in a database is a data- driven Web site As a result of the enhanced functionality that data- driven Web sites bring about, ... FirstName="John" AND LastName="Smith" A relational database is a collection of related tables from which data can be accessed To access data in relational databases, you use structured query language...
- 40
- 540
- 0
Tài liệu Module 1: Displaying Data from a Database ppt
Ngày tải lên :
21/12/2013, 19:15
... Displaying Data from a Database Database Architecture Slide Objective To provide an overview of database architecture Lead-in A database is a collection of data that you can sort, search, add ... to a database A site that enables users to search, retrieve, and update data in a database is a data- driven Web site As a result of the enhanced functionality that data- driven Web sites bring about, ... FirstName="John" AND LastName="Smith" A relational database is a collection of related tables from which data can be accessed To access data in relational databases, you use structured query language...
- 40
- 451
- 0
Tài liệu Connecting to a Text File pptx
Ngày tải lên :
24/12/2013, 05:15
... OleDbDataAdapter da = new OleDbDataAdapter("SELECT * FROM [Categories.txt]", ConfigurationSettings.AppSettings["TextFile_0119_ConnectString"]); // Create and fill the table DataTable dt = new DataTable("Categories"); ... into a text file data source The Jet database engine can access other database file formats through Indexed Sequential Access Method (ISAM) drivers specified in the Extended Properties attribute ... Filename File format Field names, widths, and data types Character set Special data type conversions The first entry in the schema.ini file is the text filename enclosed in square brackets For example:...
- 4
- 348
- 0
Tài liệu Reading Rows from a SqlDataReader Object docx
Ngày tải lên :
21/01/2014, 07:20
... that a DataReader object ties up the Connection object, and no other commands can be executed while there is an open DataReader for that Connection The following example closes productsSqlDataReader ... discontinuedColPos = productsSqlDataReader.GetOrdinal("Discontinued"); You can then use these int values to get the column values from productsSqlDataReader: while (productsSqlDataReader.Read()) { Console.WriteLine(productsSqlDataReader[productIDColPos]); ... Console.WriteLine(productsSqlDataReader[productIDColPos]); Console.WriteLine(productsSqlDataReader[productNameColPos]); Console.WriteLine(productsSqlDataReader[unitPriceColPos]); Console.WriteLine(productsSqlDataReader[discontinuedColPos]);...
- 5
- 305
- 0
Tài liệu Updating a Data Source with Data from a Different Data Source doc
Ngày tải lên :
21/01/2014, 11:20
... tracks changes made to data by maintaining multiple versions of each row allowing the data to be reconciled later to a data source using a DataAdapter The data source to which the DataSet is reconciled ... destination DataAdapter is called using the DataSet containing the changes as the data object argument; this applies the changes to the destination data source The destination DataSet is then cleared ... { // Create a DataSet of the added, modified, and deleted records DataSet dsDelta = dsSource.GetChanges(DataRowState.Added | DataRowState.Modified | DataRowState.Deleted); if (dsDelta != null)...
- 4
- 326
- 0
Accuracy of Clinical Signs in the Diagnosis of Pulmonary Tuberculosis: Comparison of Three Reference Standards Using Data from a Tertiary Care Centre in Rwanda doc
Ngày tải lên :
22/03/2014, 18:20
... unilateral apical infiltrates, haemoptysis and cavities, and unilateral apical infiltrates and fever This model provided significant better fit to the data than model Model is a three-latent class ... Table compares estimates for Se, Spe and prevalence obtained by bivariate analysis with culture and composite reference standard and by the LCA approach Most values are similar, only the prevalence ... standards Both a latent class and a composite reference standard approach suggested that the prevalence of TB in this group of patients was approximately 44%, and thus a relative 16% higher than...
- 7
- 506
- 0
Báo cáo khoa học: "Automatic Acquisition of Script Knowledge from a Text Collection" docx
Ngày tải lên :
31/03/2014, 20:20
... Parser: Japanese Dependency/Case Structure Analyzer In Proceedings of The International Workshop on Sharable Natural Language Resources, Nara, Japan, pages 48-55 Daniel Marcu 2000 The Theory and ... Processing Research Report 37-5 IPA(Information-technology Promotion Agency, Japan) 2002 Generic Engine for Transposable Association: GETA http://geta.ex.nii.ac.jp/ Sadao Kurohashi and Makoto Nagao 1994 ... subjects and/or objects This limitation comes from our [organization] find [human] [organization] arrest [human] >< [organization] re-arrest [human] [human] surrender [act] • • [organization] search...
- 4
- 351
- 0
Báo cáo y học: " The prevalence of common mental disorders and PTSD in the UK military: using data from a clinical interview-based study" pdf
Ngày tải lên :
11/08/2014, 17:20
... Milliken et al (2007) age; percentage for all other variables c UK data weighted to take account of sampling weights d Demographic data are not separately available for those on active duty and those ... US data are limited in several ways First, although the data relate to the same Iraq deployment, they were collected in different ways The PDHRA data was collected cross-sectionally in 20056 and ... the final response rate was 76% Analysis All statistical analyses were undertaken using the statistical software package STATA (version 10.0) [22] Weighted and unweighted (not shown) prevalence...
- 12
- 469
- 0
báo cáo khoa học: " Detection and validation of single feature polymorphisms using RNA expression data from a rice genome array" pot
Ngày tải lên :
12/08/2014, 03:20
... AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA ... TGAAGTTGAGTTGTCTTGAAGTGGGTCACTATGAAAACTATCAGCTGTCATTATACTTAACTGGGAAAATGCAATGAAGTTATTTTCTGATTTCTCCTGA : 100 I TGAAGTTGAGTTGTCTTGAAGTGGGTCACTATGAAAACTATCAGCTGTCATTATACTTATCTGGGAAAATGCAATGAAGTTATTTTCTGATTTCTCCTGA ... AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : Os s.33510.1.S2 2_at P I F S P I F S GTAGATTTGTAGAGAAACAACCCTGTAAATCCGGTGAT...
- 10
- 250
- 0
Báo cáo y học: "Hyperuricemia and the risk for subclinical coronary atherosclerosis - data from a prospective observational cohort study" potx
Ngày tải lên :
12/08/2014, 15:23
... raw data sets and takes responsibility for the integrity of the data and the accuracy of the data analysis Takeda Pharmaceuticals International, Inc did not have access to the raw data, and Takeda ... 114:1761-1791 Tanaka M, Tomiyasu K, Fukui M, Akamabe S, Kobayashi-Takenaka Y, Nakano K, Kadono M, Hasegawa G, Oda Y, Nakamura N: Evaluation of characteristics and degree of remodeling in coronary atherosclerotic ... antioxidant defense in humans against oxidant- and radical-caused aging and cancer: a hypothesis Proc Natl Acad Sci USA 1981, 78:6858-6862 Gagliardi AC, Miname MH, Santos RD: Uric acid: a marker...
- 8
- 350
- 0
Báo cáo y học: "Health related quality of life in trauma patients. Data from a one-year follow up study compared with the general population" potx
Ngày tải lên :
13/08/2014, 23:20
... the data, performing the data analyses and writing the article LS also collected data ISB, LS and HM participated in the planning of the study and discussions during data analyses, read the manuscript ... replaced according to the SF-36 manual [47] When an item was missing on the HADS and IES, missing data were replaced with the patients’ mean value for each subscale Data on categorical variables ... trauma patients who did not require intensive-care treatment • Identify predictors of health-related quality of life after trauma and hospital stay among demographic Page of 12 data, trauma characteristics,...
- 12
- 383
- 0
Tài liệu Create a New Table with Data from Existing Tables doc
Ngày tải lên :
21/01/2014, 12:20
... build the data adapter ' and fill the data table Dim odaResults As _ New OleDb.OleDbDataAdapter("Select * From MyProdAndCat", BuildCnnStr("(local)", "Northwind")) odaResults.Fill(dtResults) Catch ... odaResults.Fill(dtResults) Catch excp As Exception MessageBox.Show(excp.Message) Exit Sub End Try ' Assign the data table to the data grid's DataSource property Me.dgResults.DataSource = dtResults End Sub ... DataSource property is set to the data table that was filled Listing 6.17 frmHowTo6_7.vb: Loading the Form Private Sub btnExecute_Click(ByVal sender As System.Object, ByVal e As System.EventArgs)...
- 4
- 376
- 0
Tài liệu Hyperlink from a Row in the Data Grid to a Detail Page ppt
Ngày tải lên :
21/01/2014, 12:20
... Private Sub Page_Load(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles MyBase.Load 'Put user code to initialize the page here Dim odaProdIndiv As OleDb.OleDbDataAdapter odaProdIndiv ... First Page of This How-To Object Property OleDbDataAdapter ID Setting odaProducts SelectCommand SELECT ProductID, ProductName FROM Products DataSet ID dsProducts DataGrid dgProducts DataSource ... DataKeyField ProductID DataMember Products ID hplReturnToMain NavigateURL HyperLink ID wfrmMain.aspx Right-click on the DataGrid control and choose Property Builder Click on the Columns tab and...
- 5
- 392
- 0
Tài liệu Báo cáo khoa học: "Creating a Multilingual Collocation Dictionary from Large Text Corpora" docx
Ngày tải lên :
22/02/2014, 02:20
... collocation's keys occur on the same sentence, as they are in a syntactical relation) When parallel corpora are available, also the translation equivalents of the collocation context are displayed, ... as target paragraph We perform two kinds of tests on the paragraphs in this span: a test of paragraph content, and a test of paragraphs relative size matching The first test compares the paragraphs' ... paragraph alignment method is more complex; it is length-based and integrates a shallow content analysis It begins by individuating a paragraph in the target text which is a first candidate as...
- 4
- 479
- 0
Báo cáo khoa học: "A DOM Tree Alignment Model for Mining Parallel Data from the Web" doc
Ngày tải lên :
08/03/2014, 02:21
... information contained in the parallel data and effectively uses it to pinpoint the location holding more parallel data This approach is based on our observation that parallel pages share similar ... documents Parallel hyperlinks are used to pinpoint new parallel data, and make parallel data mining a recursive process Parallel text chunks are fed into sentence aligner to extract parallel sentences ... 130 Table Quality of Mined Parallel Sentences As we know, the absolute value of mining system recall is hard to estimate because it is impractical to evaluate all the parallel data held by a bilingual...
- 8
- 435
- 0
Báo cáo khoa học: "From route descriptions to sketches: a model for a text-to-image translator" doc
Ngày tải lên :
08/03/2014, 07:20
... report 540, M.I.T Artificial Intelligence Laboratory, Cambridge, MA A Yamada, T Yamamoto, H Ikeda, T Nishida, and S Doshita 1992 Reconstructing spatial image from natural language texts In Proc of ... representation of RDs, we need a prototypical model of their referent which is the route We have decomposed it into a path and landmarks A path is made up of transfers and relays Relays are abstract ... (landmarks), or a turn and a landmark, mentioned in the text immediately one after •the other Concerning the ambiguity related to the location of landmarks, one can either choose an arbitrary...
- 3
- 307
- 0
Báo cáo khoa học: "Creating a Multilingual Collocation Dictionary from Large Text Corpora" ppt
Ngày tải lên :
08/03/2014, 21:20
... collocation's keys occur on the same sentence, as they are in a syntactical relation) When parallel corpora are available, also the translation equivalents of the collocation context are displayed, ... as target paragraph We perform two kinds of tests on the paragraphs in this span: a test of paragraph content, and a test of paragraphs relative size matching The first test compares the paragraphs' ... paragraph alignment method is more complex; it is length-based and integrates a shallow content analysis It begins by individuating a paragraph in the target text which is a first candidate as...
- 4
- 353
- 0
Báo cáo khoa học: "A Multi-resolution Framework for Information Extraction from Free Text" pptx
Ngày tải lên :
23/03/2014, 18:20
... of anchor pair A i and A j 5.3 Evaluation of templates At this stage, we have a set of accepted integral relation paths between any anchor pair A i and A j The next task is to merge appropriate ... templates 5.1 Evaluation of relation path In the first stage, we evaluate from training data the relevance of relation path Path l = [A i , Rel ,…, Rel n , A j ] between candidate anchors A i and ... evaluate all possible candidate templates, and output the final template For the case of relation extraction task, the final templates are the same as an extracted binary relation The overall architecture...
- 8
- 345
- 0
Turbulent diffusion from a point source, laboratory data
Ngày tải lên :
18/05/2014, 19:36
... horizontal rake $ xW, y/k and z,/h are maximum concentration, lateral position, and location of maximum ~n~nt~t~on from vertical rake at that hrterai position R, in this case is zero The actual offset ... were drawn to fit the data as measured, but a generous allowance was made for scatter in order that they might also satisfy our physical intuition The graph suggests that the largest concentrations ... eo.hand y,/h are the value and lateral position of the maximum concentration For the elevation of the rake, see the adjacent column and note t t xa and z/h are centerline concentration and elevation...
- 34
- 213
- 0