re defining liver failure associated with cirrhosis towards the construct of a treatment directed classification
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc
Ngày tải lên :
07/03/2014, 12:20
... were used: GLU R1 5A forward (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), ... TGGATGCTATTAATGATGATGGCTC-3¢), GLU H44 7A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU T46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCA ... toroid, and is closely similar to that of the catalytic domain of A awamori and T thermosaccharolyticum glucoamylases, with the active site at the narrower end of barrel There is no terminal starch-binding...
- 11
- 548
- 0
Hints towards the formation of a more comprehensive theory of life. pptx
Ngày tải lên :
30/03/2014, 01:20
... speculations, as contained in the accompanying pages, are wholly inapplicable Almost all nations, even the most savage, agree in the belief that individuals of the human race, after they have ceased ... them but as far as they are co-inherent, and therefore as reciprocally the measures of each other Nor, again, can we finish the process without having the idea of motion as its immediate product ... constitutes the whole sphere of these rudimental animals In the snail and muscle, the residuum of the coral reappears, but refined and ennobled into a part of the animal The whole class is characterised...
- 40
- 448
- 0
Báo cáo hóa học: "Research Article A Modified Run-Length Coding towards the Realization of a RRO-NRDPWT-Based ECG Data Compression System" pdf
Ngày tải lên :
21/06/2014, 05:20
... for hardware realization The hardware simulation result shows that with the MRLC scheme, the hardware cost of realizing the RRO-NRDPWT-based ECG data compression system can be dramatically reduced ... MIT-BIH arrhythmia database were investigated Each signal contains about a 15 minutes length of sampled data The measurement results are depicted in Figure Figure reveals that an approximately linear ... development of ECG data compression A quantitative relation between distortion and the degree of clinical information preservation was evaluated in [16] The evaluation showed that reproduced ECG waveforms...
- 8
- 394
- 0
Báo cáo sinh học: "Functions of O-fucosyltransferase in Notch trafficking and signaling: towards the end of a controversy" pptx
Ngày tải lên :
06/08/2014, 18:21
... should co-localize better with the sum of the signals of the different ER markers This remains to be tested Analysis by Okajima et al [17] of the role of the Ofucosylation activity of ofut1 during ... ER markers seen by Sasamura et al [13] Okajima et al [17] therefore propose that Notch accumulates in ofut1 mutant Acknowledgements We thank A Bardin and C Perdigoto for critical reading of the ... Journal of Biology 2008, 13 Sasamura T, Ishikawa HO, Sasaki N, Higashi S, Kanai M, Nakao S, Ayukawa T, Aigaki T, Noda K, Miyoshi E, Taniguchi N, Matsuno K: The O-fucosyltransferase O-fut1 is an...
- 5
- 419
- 0
Báo cáo khoa học: "Liver dysfunction associated with artificial nutrition in critically ill patients" pdf
Ngày tải lên :
13/08/2014, 03:20
... that cholestasis and the mixed pattern are the two most frequent types of LD The elevations of serum transaminases, alkaline phosphatase, and bilirubin are the changes most often associated with ... than 280 IU/l, gamma-glutamyl-transferase of more than 50 IU/l, or bilirubin of more than 1.2 mg/dl, plus aspartate aminotransferase of more than 40 IU/l, alanine aminotransferase of more than ... (b) liver necrosis: aspartate aminotransferase of more than 40 IU/l, alanine aminotransferase of more than 42 IU/l, or INR of more than 1.4; and (c) mixed pattern: alkaline phosphatase of more...
- 12
- 311
- 0
Pulmonary tuberculosis associated with increased number and percentage of natural killer and B cells in the peripheral blood pot
Ngày tải lên :
29/03/2014, 03:20
... diseases The study was limited by lack of access to the patient records therefore it was not possible to correlate the laboratory data with the clinical findings Peripheral blood subset data of the ... Unit at King Khalid University Hospital Riyadh There were female and male patients with the mean age of 27 ± years Diagnosis of PTB was confirmed on clinical, radiological and microbiological evidence ... 145: 252-260 Vidyarani M, SelvarajP, Jawahar MS, Rajeswari ND, Anbalagan S, Narayanan PR (2007) Intracellular granzyme A expression of peripheral blood lymphocyte subsets in pulmonary tuberculosis...
- 5
- 419
- 0
Báo cáo khoa học: "bcl-2 expression is not associated with survival in metastatic cutaneous melanoma: A historical cohort study" pptx
Ngày tải lên :
09/08/2014, 07:21
... observed that patients older than 60 years were at greater risk for subcutaneous metastases of CM, and also that age had no effect on the survival of patients with other types of metastasis The larger ... 22% of the cases diagnosed before the age of 40 [26] We were unable to evaluate the histological characteristics of primary tumors because this information was not available for all cases Also, ... (rather than only of their presence), may allow for an adequate use of BCL-2 family members as effective predictors of survival in CM It has been shown that the treatment of melanoma cells with...
- 7
- 343
- 0
Báo cáo khoa học: " Local tumor control and toxicity in HIV-associated anal carcinoma treated with radiotherapy in the era of antiretroviral therapy" pps
Ngày tải lên :
09/08/2014, 10:21
... because of the HIV-infection harbouring a risk of complications and treatment- related death or because of other reasons, such as the particular anatomical presentation of the disease There are some ... Pierart M: Concomitant radiotherapy and chemotherapy is superior to radiotherapy alone in the treatment of locally advanced anal cancer: results of a phase III randomized trial of the European ... patients in the pre- and post-HAART era (16 patients with HAART) that the actuarial 2-year overall survival did not change after introduction of HAART [1] There must be factors others than age...
- 9
- 377
- 0
Báo cáo y học: "Rheumatoid cachexia is associated with dyslipidemia and low levels of atheroprotective natural antibodies against phosphorylcholine but not with dietary fat in patients with rheumatoid arthritis: a cross-sectional study" pdf
Ngày tải lên :
09/08/2014, 13:22
... Total cholesterol and HDL levels in RA are inversely associated with the acute phase response, regardless of whether patients are treated with antirheumatic drugs or not Furthermore, patients with ... The exclusion criteria were: current malignancy, severe heart failure according to the New York Heart Association (NYHA) classification >3 [29], severe renal failure (glomerular filtration rate ... subcutaneous adipose tissue was analyzed by gas liquid chromatography as described previously [36] The amounts of FA were given as the relative percentage of the sum of the FA analyzed Biochemical...
- 11
- 549
- 0
Báo cáo y học: "Nucleosome rotational setting is associated with transcriptional regulation in promoters of tissue-specific human genes" pot
Ngày tải lên :
09/08/2014, 20:22
... technology and aligned at the dyad, their average nucleotide profile may theoretically show such a periodic pattern as a consequence of nucleosome rotational positioning rather than as a cause Here, ... proceed with the required efficiency and may decrease the expression of the gene, thus potentially causing abnormal phenotypes Materials and methods Transcription start site database All TSSs were ... P, Tarraga J, Medina I, Alloza E, Montaner D, Dopazo J: FatiGO +: a functional profiling tool for genomic data Integration of functional annotation, regulatory motifs and interaction data with...
- 13
- 339
- 0
Báo cáo y học: " Management of HIV-1 associated hepatitis in patients with acquired immunodeficiency syndrome: role of a successful control of viral replication" ppsx
Ngày tải lên :
10/08/2014, 05:22
... and the relative DNA or RNA detections by polymerase chain reaction Page of (PCR), were negative as well as the auto-antibody titres A liver ultrasound showed only a mild hepatomegaly, whereas ... when, despite the persistence of abnormal LFTs, the treatment was restarted with a darunavir/ritonavir + enfuvirtide + raltegravir-based HAART, taking in account the results of a new GRT After only ... RNA by PCR analysis; a liver ultrasound Esposito et al AIDS Research and Therapy 2011, 8:9 http://www.aidsrestherapy.com/content/8/1/9 Page of Table Therapeutic history of the patients Antiretroviral...
- 5
- 326
- 0
Báo cáo y học: "A dentigerous cyst associated with bilaterally impacted mandibular canines in a girl: a case report" potx
Ngày tải lên :
10/08/2014, 23:21
... position of the canines and the dentigerous cyst The resultant data were reconstructed, and multi-planar and orthoradial views were examined The coronal and axial slices revealed that the dentigerous ... dentigerous cyst was larger than was apparent on the digital pantomograph The cyst encompassed the crowns of both the right mandibular canine and the left mandibular canine The border of the dentigerous ... performed the incisional biopsy, curettage, and exposure of the mandibular canines PG performed the histological examination of the biopsy All authors read and approved the final manuscript Competing...
- 4
- 316
- 0
Báo cáo y học: " Systemic lupus erythematosus associated with type 4 renal tubular acidosis: a case report and review of the literatur" pps
Ngày tải lên :
11/08/2014, 00:23
... data and drafted the manuscript HP and JL contributed to the treatment of the patient LY and OL participated in critical revision of the report and helped draft the manuscript All authors read ... Discussion The clinical manifestations of SLE are many and varied, making it a plausible component of many differential diagnoses [5] It is one of several diseases known as the great imitators” because ... http://www.jmedicalcasereports.com/content/5/1/114 Page of report and any accompanying images A copy of the written consent is available for review by the Editor-inChief of this journal Abbreviations RTA: renal tubular acidosis; SLE:...
- 5
- 509
- 0
Báo cáo y học: "Küttner’s tumor of the sub-mandibular gland associated with fibrosclerosis and follicular hyperplasia of regional lymph nodes: a case report" pdf
Ngày tải lên :
11/08/2014, 00:23
... sialadenitis of the submandibular.] HNO 1977, 25(3):81-92 Kitagawa S, Zen Y, Harada K, Sasaki M, Sato Y, Minato H, Watanabe K, Kurumaya H, Katayanagi K, Masuda S, Niwa H, Tsuneyama K, Saito K, Haratake ... Kojima M, Nakamura S, Itoh H, Yamane Y, Tanaka H, Sugihara S, Sakata N, Masawa N: Sclerosing variant of follicular lymphoma arising from submandibular glands and resembling Kuttner tumor: A report ... hyperplasia of the regional lymph nodes Some case reports of lymphomas with a background of autoimmune disease or chronic inflammation appear in the literature [9-11] The consent of our patient was...
- 7
- 363
- 0
Báo cáo y học: "Emphysema is associated with increased inflammation in lungs of atherosclerosis-prone mice by cigarette smoke: implications in comorbidities of COPD" ppsx
Ngày tải lên :
11/08/2014, 03:20
... lungs of ApoE-/- mice, thereby leading to an increased inflammatory response and development of premature emphysema in these mice Reduced FEV with airflow limitation is often associated with atherosclerosis ... exposure and acceleration of atherosclerosis and vascular inflammation in an animal model JAMA 2005, 294:3003-3010 27 Araujo JA, Barajas B, Kleinman M, Wang X, Bennett BJ, Gong KW, Navab M, Harkema ... Kugiyama K, Sugiyama S, Ohgushi M, Matsumura T, Doi H, Ogata N, Oka H, Yasue H: Impairment of endothelium-dependent relaxation of rabbit aortas by cigarette smoke extract–role of free radicals and...
- 10
- 371
- 0
Báo cáo y học: "Emphysema is associated with increased inflammation in lungs of atherosclerosis-prone mice by cigarette smoke: implications in comorbidities of COPD" potx
Ngày tải lên :
11/08/2014, 06:22
... lungs of ApoE-/- mice, thereby leading to an increased inflammatory response and development of premature emphysema in these mice Reduced FEV with airflow limitation is often associated with atherosclerosis ... exposure and acceleration of atherosclerosis and vascular inflammation in an animal model JAMA 2005, 294:3003-3010 27 Araujo JA, Barajas B, Kleinman M, Wang X, Bennett BJ, Gong KW, Navab M, Harkema ... Kugiyama K, Sugiyama S, Ohgushi M, Matsumura T, Doi H, Ogata N, Oka H, Yasue H: Impairment of endothelium-dependent relaxation of rabbit aortas by cigarette smoke extract–role of free radicals and...
- 10
- 487
- 0
báo cáo khoa học: "Trichoderma viride cellulase induces resistance to the antibiotic pore-forming peptide alamethicin associated with changes in the plasma membrane lipid composition of tobacco BY-2 cells" potx
Ngày tải lên :
11/08/2014, 11:21
... to the initial rate Data points are averages of three to five measurements and error bars represents SE examined gave an alamethicin resistance in the vicinity of that attained after CM treatment ... respiration rate remaining after 10 incubation with 20 µg ml-1 alamethicin compared to the initial rate Each data point represents the mean of four biological replicates and the error bars represent ... alone resulted in similar resistance compared to the full h enzyme treatment (Table 1) The DNA stain propidium iodide cannot pass the plasma membrane of intact cells and can therefore be used as...
- 13
- 293
- 0
Báo cáo y học: "Henoch-Schönlein nephritis associated with streptococcal infection and persistent hypocomplementemia: a case report" pot
Ngày tải lên :
11/08/2014, 11:22
... and MC Vozmediano analyzed and interpreted our patient data regarding the renal disease J Pérez-Alvárez and J Blanco performed the histological examination of the kidney, and were major contributors ... de Anatom a Patológica Hospital Clínico Universitario San Carlos Av Prof Martin Lagos, s/n 28040 Madrid Spain Page of 14 Yoshizawa N, Yamakami K, Fujino M, Oda T, Tamura K, Tsumoto K, Sugisaki ... infiltration and the presence of IgA deposits led us to a definitive diagnosis of HSP These findings remark the importance of renal biopsy in the diagnosis of the majority of glomerular diseases...
- 5
- 406
- 0
Báo cáo y học: "A severe case of erythrodermic psoriasis associated with advanced nail and joint manifestations: a case report" pptx
Ngày tải lên :
11/08/2014, 12:20
... this article as: Teran et al., A severe case of erythrodermic psoriasis associated with advanced nail and joint manifestations: a case report Journal of Medical Case Reports 2010, 4:179 Page of ... reviewed the final manuscript All the authors read and approved the final manuscript Author Details Department of General Pediatrics, Centro Pediatrico Albina Patiño, Cochabamba, Bolivia Received: ... of the manuscript and aided in the final editing of the text CB retrieved most of the information relevant to the case presentation CNTE was in charge of our patient and critically reviewed the...
- 3
- 415
- 0
Báo cáo y học: "Platypnea and orthodeoxia associated with Pneumocystis jiroveci and Cytomegalovirus pneumonia: a case report" potx
Ngày tải lên :
11/08/2014, 14:21
... failure diagnosis and management TK is the corresponding author and was responsible for manuscript preparation and the pulmonary investigation of the case PV carried out the renal failure diagnosis ... out the pulmonary investigation of the case IM carried out the nephrological investigation of the case AV carried out vasculitis diagnosis and management of the case CB carried out the respiratory ... several isolated case reports, speculation over mechanisms is often geared to whatever special features were found in the patient been reported We present a case of a patient with severe platypnea...
- 4
- 456
- 0