rats 200 250 g were obtained from charles river laboratories laprairie co quebec canada these isogenic rats were used as donors and recipients to simulate autologous implants clinically
CELL SELECTION AND RESELECTION pot
... đọc sóng mang tính to n cường độ trung bình sóng trị trung bình tính to n dựa mẫu đo kéo dài từ 3s đến 5s BCCH nhận dạng cụm hiệu chỉnh tần số, tìm BCCH MS đồng đọc thông tin BCCH Thời gian cực ... decode đầy đủ BCCH serving cell 30s MS decode DATA BLOCK Neighbour chứa tham số cell reselection sóng mang 5phút MS giám sát cell mạnh 30s/lần (BSIC) có sóng mang đưa vào danh sách cố g ng decode ... PROCEDURE MEASUMENTS FOR CELL RESELECTION MS giám sát sóng mang BCCH tính giá trị trung bình, số mẫu để tính giá trị trung bình tính: Max {5 , ((5 * N + 6) DIV 7) * BS_PA_MFRMS / 4} N: số sóng mang BCCH...
- 17
- 956
- 2
Tài liệu Báo cáo " Effecting of medium composition on biomass and ginsenoside production in cell suspension culture of Panax vietnamensis Ha et Grushv " doc
... 1960s and commercial application has underway since the late 1980s The powder and extracts from ginseng cell culture were used to make health foods, drinks and cosmetics The ginseng culture has continued ... tăng t 5.4 ñ n 10.3 g/ L tăng n ng ñ ñư ng t ñ n 50 g/ L Ti p t c tăng n ng ñ ñư ng s kìm hãm s sinh trư ng t bào s t ng h p ginsenoside Tương t , n ng ñ 30 mM nitrogen t i ưu cho s sinh trư ng ... 2-10 mm and then were inoculated into MS solid medium (Murashige and Skoog, 1962) containing 30 g/ L sucrose, mg/L 2,4-D, and 0.1 mg/L kinetin After month callus were induced The callus were subcultured...
- 6
- 624
- 1
Báo cáo " Cell suspension culture Panax ginseng C. A. Meyer: Role of plant growth regulators and medium composition on biomass and ginsenoside production " docx
... c (7.2 mg /g tr ng lư ng khô, t ng s ginsenoside) sinh kh i 10.1 g/ L tr ng lư ng khô n ng ñ mg/L IBA Còn ñ i v i cytokinin n ng ñ tăng t 0.1 ñ n 1.0 mg/L (BA kinetin) ñã không nh hư ng ñ n s sinh ... However, ginsenoside production was much higher in IBA or NAA containing medium (Table 1) Considering these results, mg/L IBA was determined to be optimal for the cell growth (10.1 g/ L DW) and ginsenoside ... investigated, 30 g/ L sucrose enhanced biomass yield (180 g/ L FW, and 10.8 g/ L DW), and ginsenoside production (total ginsenoside production upto 6.56 mg /g DW) Further increase of sucrose concentration...
- 6
- 492
- 0
Báo cáo khoa học: Super life – how and why ‘cell selection’ leads to the fastest-growing eukaryote doc
... obtained by measuring the gas composition of the inward and outward gas ows Gas exchange was determined by leading the inward and outward gas ows through a mass spectrometer model MM 8-80F (VG Instruments ... biomass dry weight (g L)1), D%gas is the percentage gas exchange measured at 23 C at which the molar gas volume (Mvol) is 24.282 L (according to the BoyleGay Lussac law), and fg is the gas ow (Lặh)1) ... in the yeast population and could not be used to calculate average relative changes in cell sizes Therefore, we used a phase-contrast microscope to measure the average relative changes in cell...
- 17
- 384
- 0
Báo cáo " Effects of macro elements on biomass and ginsenoside production in cell suspension culture of Ngoc Linh ginseng " docx
... strength led to the greatest ginsenoside content (6.1 mg /g DW) Higher strengths (1.0, 1.5, and 2.0) of MgSO4 were more favorable for both cell biomass growth and ginsenoside accumulation, as seen ... the highest cell biomass DW (10.4 g) and ginsenoside content (5.5 mg /g DW) Cell growth and ginsenoside accumulation also increased with higher CaCl2 concentrations; the greatest ginsenoside content ... fact, the greatest ginsenoside production (10.3 mg /g DW) was obtained when 0.5 strength level of NH4NO3 from the culture medium Table Biomass growth of ginseng cell was affected by concentration...
- 5
- 568
- 0
Báo cáo khoa học: ERK and cell death: ERK location and T cell selection pdf
... localized to the plasma membrane (Fig 2) On the other hand, positive selecting ligands induce a slow and sustained activation of ERK originating from the Golgi and leading to pERK being distributed ... selectors not recruit Grb2 ⁄ SOS to LAT They only activate Ras-GRP1 and induce its recruitment to the Golgi [16] However, the fact that negative selecting ligands activate and recruit both Ras-GRP1 ... positive and negative selecting ligands [11] This resembles what has been reported for JNK and p38 [39] and again suggests that sequestration of pERK at the plasma membrane by negative selecting ligands...
- 9
- 350
- 0
Báo cáo y học: "VLA-4-dependent and -independent pathways in cell contactinduced proinflammatory cytokine production by synovial nurselike cells from rheumatoid arthritis patients" potx
... (5′-CATCATCAAGTATGAGAAGCC-3′ and 5′-GCTGAATACCATTTCCAGTG-3′) [10], to SDF-1α (5′-TGGATTCAGGAGTACCTGGA-3′ and 5′-CGTATGCTATAAATGCAGGG-3′) [11] or to CXCR4 (5′-TTCTACCCAATGACTTGTG-3′ and 5′-ATGTAGTAAGGCAGCCAACA-3′) ... cut into pieces and digested with 0.1% collagenase Type IV (Sigma, St Louis, MO, USA), 0.1% hyaluronidase (Sigma), and 0.01% DNAse (Sigma) The resultant single-cell suspension was plated onto culture ... strong pseudoemperipolesis ability, was used in this study Total RNA was isolated using TRIZOL (Gibco BRL) according to the manufacturer’s instructions First-strand cDNA synthesis from total...
- 8
- 358
- 0
Báo cáo y học: "B cells in Sjögren’s syndrome: indications for disturbed selection and differentiation in ectopic lymphoid tissue" doc
... of autoantigens, B-cell biology, the cellular basis of autoantibody production, the role of cytokines and chemokines, autoantibody-encoding immunoglobulin variable region (IgV) genes and associations ... glands in pSS: unorganized diffuse infiltrates, focal periductal T-cell and B-cell aggregates lacking GC characteristics, and ectopic GC-like structures [5,10,27-34] Ectopic GC formation is associated ... pSS, including antibodies against ubiquitous or organ-nonspecific autoantigens (for example Ro/SSA, La/SSB, α-Fodrin and the Fc fragment of IgG) and to mostly organ-specific autoantigens (for example...
- 12
- 332
- 0
Báo cáo y học: "DNA-like class R inhibitory oligonucleotides (INH-ODNs) preferentially block autoantigen-induced B-cell and dendritic cell activation in vitro and autoantibody production in lupus-prone MRL-Faslpr/lpr mice in vivo" potx
... Linear control, R = random TLR9-agonists Class Properties 4084-F CpG-2336 ggGGACGACGTCGTGgggggg A(D) Lowercase PS linkages CpG-1826 TCC ATG ACG TTC CTG ACG TT B(K) Linear, murine CpG -2006 TCG TCG ... nucleotide OVHG) 3' OVHG-scr medium GCT GCA CCT GGA TGG GAA B 3' linear 3' OVHG-long AGG CCT GGA TGG GAA R 3' long overhang (9 nucleotide OVHG) 3' OVHG-scr long GCA CCT GGA TGG GAA B 3' linear ... CCT/GGG INH-48 TAT GGA TTT TAA CTT ACC GCG GCA B Lacks CCT/GGG 5' OVHG-short CCT GGA TGG GAA TTC CCA TCC R 5' short overhang (3 nucleotide OVHG) 5' OVHG-scr short CCT GGA TGG GAA CTT ACC GCT...
- 16
- 318
- 0
Báo cáo y học: "Type I interferon receptor controls B-cell expression of nucleic acid-sensing Toll-like receptors and autoantibody production in a murine model of lupus" doc
... and soluble isoforms and is critical for ligand binding and signal transduction through the receptor [27,28] Negative regulators of IFN and other proinflammatory cytokine signaling, including ... isotype switching to pathogenic IgG isotypes in SLE as MyD88-/- and TLR9-/- SLE mice lack autoantibodies of the IgG2a and IgG2b subclasses [19] Mice treated with a single intraperitoneal injection ... suppressor of cytokine signaling (SOCS1) and the Tyro-3, Axl, and Mer (TAM) receptors, have been shown to associate with, and regulate signaling through, the IFNAR1 chain [29,30] Signaling through the...
- 10
- 408
- 0
Báo cáo y học: " Transcriptome analysis of functional differentiation between haploid and diploid cells of Emiliania huxleyi, a globally significant photosynthetic calcifying cell" potx
... cytoplasmic DHC 400 200 800 600 400 400 200 400 200 Amplifying from GS03135-GS02889 GS00132 phototropin homolog GS00920 phototropin homolog Orphan 1N clusters GS05223 false agglutinin homolog 200 ... (P = 0.0078) In contrast, GS09138 was composed of 13 ESTs from the 1N library and from the 2N Genome Biology 2009 , 10:R114 http://genomebiology.com /2009 /10/10/R114 Genome Biology 2009 , library ... Biology 2009 , 10:R114 http://genomebiology.com /2009 /10/10/R114 Genome Biology 2009 , such as flagellar dyneins and basal body components, will probably be intriguing new targets for phylogenomic...
- 33
- 652
- 0
báo cáo khoa học: " Effect of clone selection, nitrogen supply, leaf damage and mycorrhizal fungi on stilbene and emodin production in knotweed" doc
... dry wt; cm2 .g- 1) to assess leaf thickness were calculated The belowground biomass was measured after washing and cleaning of the roots and rhizomes that were dried, weighed, ground and analysed ... (Figure 11b) in FJ (from to 3) and by mycorrhizal inoculation (Figure 11c) both in FJ (from to 3) and FBM (from to 1.7) Two things that likely contributed to the increased piceid/N ratio were ... increase of piceid in FJ subjected to leaf damage, resulting from a defence response, and a decrease of nitrogen in FJ and FBM, resulting from mycorrhizal inoculation This decrease was likely caused...
- 14
- 254
- 0
Báo cáo y học: "Dendritic cell subsets dynamics and cytokine production in SIVmac239-infected Chinese rhesus macaques" pptx
... The sequences of the primers used were: 5’-TCGGTCTTAGCTCCATTAGTGCC-3’ and 5’-GCTTCCTCAGTGTGTTTCACTTTC-3’; the TaqMan probe sequence was: 5’ -CTTCTGCGTGAATGCACCAGATGACGC-3’ In the probe the fluorescence ... (mean, 57 fg; range, 2.0 to 205.8 fg; P = 0.025) to 27 (mean, 77.6 fg; range, 0.8 to 405 fg; P = 0.043) p.i Afterward, the levels of IL-12 were gradually decreased to a subnormal level (Figure 5A) ... 1251.1 fg; P = 0.036), 15 (mean, 234.4 fg; range, 2.3 to 1282.5 fg; P = 0.012), and 27 (mean, 314.4 fg; range, 17.5 to 1091.5 fg; P = 0.05) p.i The IFN-a production was recovered following and then...
- 13
- 277
- 0
Báo cáo y học: "The global role of ppGpp synthesis in morphological differentiation and antibiotic production in Streptomyces coelicolor A3(2)" pdf
... the glgBI genes (SCO5440-44) are responsible for glycogen deposition in vegetatively growing cells, whereas carbon storage in aerial and sporulating cells was performed by the glgBII cluster (SCO7732-38) ... homologue present as the fourth gene in each cvn has both GTP-hydrolysing and GTP/GDP-binding activities [26], and the decrease in GTP concentration associated with the synthesis of ppGpp could ... 18 genes from cda cluster genes from act cluster genes from sugar transport systems genes from other transport systems regulatory genes adenosine deaminase genes gene from hopanoids cluster sigma...
- 18
- 435
- 0
Study of human nasal epithelial stem or progenitor cell growth and differentiation in an in vitro system
... box P3 glyceraldehyde-3-phosphate dehydrogenase GATA binding protein goblet cell hyperplasia goblet cell metaplasia glucocorticosteroids granulocyte-macrophage colony-stimulating factor guanosine-5'-triphosphate ... Ning from Shandong University (Shandong, China) The differentiation study was also collaborated with her For comparison study for hNESPCs from NP and healthy controls, Dr Yu Xue Ming from Shandong ... damage, such as hyperplasia or squamous metaplasia This disease represents as a challenging diagnosis for physicians because of their uncertain etiology and high recurrence (Newton and Ah-See, 2008 )...
- 259
- 929
- 0
Roles of long non coding RNAs in human embryonic stem cell pluripotency and neural differentiation 1
... ggagccgtagtgagcagttc atgcctcacacggagactgt aagtgggttgtttgcctttg ggcacagttagagccaactaaga ccgagcagcactaacacg gagaggcagctgagatcagaa tgagaatacgatgtctgcaggt gtggagagcaactccgatg tctgcagagctttgatgtcc ggcacacacacattaacacactt ... ggcacacacacattaacacactt ggtgtgtgagagcaattctcag aggtggttgaccttcaatgg tttgatttcttccagcattgtg gagtctgcctgttgcagga cagcgtctgacagcgaca aagttcaacaacaactgctaccaa gaagctcgtcatgcagttca ttgctgcctctttaagactagga ctggggctcaaacttctctc ... tcagctacctgaagcacagc tagtcctggtgcaggctctt tgcctaagatgcccgactt agctgctggctggtgaag aaggacaagaagcgaagcat ttcctgtcatcccctggata aaggcctcatttgaagtatcctc cactcagccctgtctctgc atggaacagagcccctacg tgtcatggaagatggagtcg...
- 83
- 381
- 0
Roles of long non coding RNAs in human embryonic stem cell pluripotency and neural differentiation 3
... lncRNAs showed the highest level of transcription in the neural progenitors, they were referred to as NPC lncRNAs These NPC lncRNAs were defined as transcripts having at least probes showing a greater ... H1-derived neurons were highly enriched for Gene Ontology terms relating to neuronal differentiation The top 10 terms are shown Gene Ontology Biological Process 10 GO Term neurogenesis generation of ... regulated lncRNAs were identified (Figure 5.1) As a further confirmation that the neural cell types derived from hESCs were expressing neural genes, a gene ontology (GO) analysis of the mRNA genes...
- 55
- 327
- 0
Roles of long non coding RNAs in human embryonic stem cell pluripotency and neural differentiation 4
... protein-RNA complexes, a series of wash steps were performed and proteins were eventually eluted, ran on an SDS-PAGE gel The SDS-PAGE gel was Coomassie-stained, and two protein bands observed ... immunoprecipitation (ChIP), as well as the isotype IgG ChIP experiments were performed Fold enrichment was calculated relative to the IgG ChIP Three positive controls, namely RS111, RS625 and RS774, were included ... that RMST was consistently upregulated when neural progenitors differentiate into neurons 128 Figure 8.3: RMST expression is upregulated during neurogenesis Levels of RMST were measured by...
- 13
- 275
- 0
Roles of long non coding RNAs in human embryonic stem cell pluripotency and neural differentiation 5
... transduction Brain development Oligodendrocyte differentiation Gene Ontology Term GO:0001764 GO:0008593 GO:0033554 GO:0030900 GO:00 22008 GO:0045747 GO:0021537 GO:0007266 GO:0007420 GO:0048709 p-value 5.28E-06 ... downregulated in both si-RMST and si-SOX2 143 Table 8.2: Gene Ontology (GO) analysis of the 152 genes in the si-RMST and siSOX2 overlap Gene Ontology Biological Process 10 Neuron migration Regulation ... overlap was also large (more than 60%), indicating that RMST and SOX2 possibly regulate a common pool of genes (Figure 8.18) In addition, a gene ontology (GO) analysis of the 152 genes downregulated...
- 34
- 316
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu