quotechar in the jdk 1 0 this can be used to specify a character that

báo cáo khoa học: " Can the ubiquitous power of mobile phones be used to improve health outcomes in developing countries" pps

... GDP($)/capita and Mobile Phone Subscriptions/capita ( 200 3) Subscriptions/capita 1. 4 1. 2 0. 8 0. 6 0. 4 0. 2 0 10 00 0 200 00 300 00 400 00 500 00 Profit through new sales, new products, marketing user acceptance ... 9.7 to 8.6 [14 ] Duration = months [ 20] Diabetes ( 10 ) HbA1c [22] Change in HbA1c statistically significant Duration = year Duration = months Diabetes (18 5) Diabetes ( 10 0) Tuberculosis (6) HbA1c ... Smoking cessation Croatia Asthma Spain Cardiovascula r disease Finland Diabetes Spain Vaccination rates Hepatitis A and B Whether reminder of the next vaccine dose sent by SMS increase compliance with...

14
401
0

Game on: How gaming can be used to make my product more engaging

Danh mục: Tiếp thị - Bán hàng

... engaging? DESIGNER I can t wait for the next great gaming experience! GAMER ARe YOU MOBILE ARe YOU CASUAL ARe YOU AVID How can I use gaming to make my product more engaging? DESIGNER (or anyone ... motivated to merely short-range activity FIGHT when they are working toward while actually reducing long- personally meaningful goals range interest in a topic” whose attainment requires activity ... social relationships, 3) a bigger sense of purpose and 4) meaningful mastery - Jane McGonigal gamification extrinsic motivators intrinsic motivators “extrinsic motivators may lead “People are best...

172
366
0

Cooking in the Field 1 - Worksheet

Danh mục: Anh ngữ phổ thông

... silhouette against the skyline Always avoid the skyline Keep to the shade and the shadows will conceal you But be careful of your own shadow Think of this You have taken cover behind a wall The sun ... cover a behind a tree b behind a hedge c behind a bush d behind a wall e behind a vehicle Answer the following questions a) What makes a uniform good at giving camouflage? Its colour and design ... answers are given below) Embers Mess tin A rut A trenching tool A scrape Dodging (potatoes) in their jackets hot glowing bits of a fire a special pan for cooking A long narrow hole made by a wheel...

10
357
0

Movement in the Field 1 - Worksheet

Danh mục: Anh ngữ phổ thông

... head and body? ii Now ask your partner his questions and listen to his answers Listen to THE ROLL again Partner A describe THE ROLL to Partner B Partner B, listen and add any information that A ... Crawl The Ghost Walk The Cat Walk Listen to the introduction again and complete the following statements a) At night you have to be quieter b) You can t see where you are going c) You have to ... with a partner and then with the whole class What are the difficulties of moving at night? What special ways are there of moving at night? In Pairs Look at the following pictures and describe them...

11
398
0

Test Your Vocabulary 2_Things in the home 1

Danh mục: Kỹ năng nói tiếng Anh

...

17
351
0

Tài liệu Nutrition in the First 1,000 Days - State of the World’s Mothers 2012 ppt

Danh mục: Sức khỏe trẻ em

... Good Fair Fair Fair Fair Fair 36 or 462 15 602 16 16 18 16 28 16 14 20 20 17 or 212 16 15 26 (16 ) 20 14 14 2 18 18 17 28 16 39 (13 ) 18 12 14 24 20 10 0, 80% 10 0% 80% † 10 0% 10 0% 10 0% 10 0% 60% 10 0% ... number of stunted children (millions) Estimated % of children stunted 200 60 Asia 18 0 50 16 0 Asia 14 0 40 Africa 12 0 30 10 0 80 20 60 Africa 40 10 20 0 19 90 19 95 200 0 200 5 2 01 0 2 01 5 202 0 19 90 19 95 ... Brazil Costa Rica Jamaica Chile R =0. 61 Czech Republic Singapore Kuwait USA Germany Overperforming relative to GDP $0 $ 10 ,00 0 $ 20, 000 $ 30, 000 $ 40, 000 $ 50, 000 GDP per capita (2 01 0 US$) — Note: All...

70
754
0

Tài liệu Báo cáo khoa học: Fra-1 targets the AP-1 site/2G single nucleotide polymorphism (ETS site) in the MMP-1 promoter docx

Danh mục: Báo cáo khoa học

... decrease in the intensity and/or a complete disappearance of some bands, indicated by arrows In contrast, bands that are more intense in the lanes containing the 1G probe appear unchanged in the ... from Fra -1 acting not only at the proximal site but also at the AP -1 site at )16 02 bp adjacent to the 2G SNP Furthermore, our data implicate Fra -1 in contributing to the increase in MMP -1 expression ... FEBS 200 3 Fig Diagram of the MMP -1 promoter region spanning the region from )15 85 bp to )16 20 bp The 1G SNP DNA contains an AP -1 consensus at )16 02 bp, and the sequence 5¢-GAA-3¢ at )16 07 bp The...

10
406
0

Báo cáo khoa học: The autophagic response to nutrient deprivation in the hl-1 cardiac myocyte is modulated by Bcl-2 and sarco⁄endoplasmic reticulum calcium stores ppt

Danh mục: Báo cáo khoa học

... [12 ] Beclin contains a Bcl-2-binding domain which may serve as a point of cross-talk between the autophagic and apoptotic pathways Recently, a BH3 domain in the Bcl-2-binding domain of Beclin ... Brady et al degradation of the autophagosomes and cargo by lysosomal proteases [2,3] The autophagic pathway is crucial for maintaining cell homeostasis and disruption to the pathway can be a ... inhibitor of cathepsin B) and baﬁlomycin A1 (Baf; 50 lm; inhibitor of the vacuolar proton ATPase) was used to block lysosomal degradation of autophagosomes [ 20] Inhibition of cathepsin activity was veriﬁed...

14
444
0

Báo cáo khoa học: Characterization of N-glycosylation consensus sequences in the Kv3.1 channel pot

Danh mục: Báo cáo khoa học

... N220Q/N229Q 0. 5 nA Wt Kv3 .1 current A Characterization of glycosylation sites in Kv3 .1 1 .0 25 ms 0. 8 60 50 Rise times (ms) g/gmax B 0. 6 0. 4 0. 2 0. 0 - 40 - 20 20 40 60 Voltage (mV) 80 40 30 20 10 10 0 Kv3.1s ... cocktail : 500 ) and centrifuged at 200 0 g for 10 at °C The supernatant was transferred to a clean tube and centrifuged at 10 0 000 g in a Sorvall TH6 41 rotor for h at °C, whereas the pellet was resuspended ... resuspended in 10 mL of lysis buffer, homogenized, and centrifuged at 200 0 g in an Eppendorf F-45- 30 -11 rotor for 10 at °C This supernatant was transferred to a clean tube and centrifuged at 10 0 000 g in...

14
406
0

Báo cáo khoa học: Tyrosine-dependent basolateral targeting of human connexin43–eYFP in Madin–Darby canine kidney cells can be disrupted by the oculodentodigital dysplasia mutation L90V ppt

Danh mục: Báo cáo khoa học

... 5Â-GATCA TGAATTGTTTCTGTCGCCAGTAACCAGCTTGGCCC CAGGAGGAGACATAGGCG-3Â; LSYTRF, 5Â-GCAAG AAGAATTGTTTCTGTCGCCAGTGAACCGGGTATAT GACAAAGGAGACATAGGCGAGAGGGGAGC-3Â The complementary sequences were used as ... cell lines) 10 àm X Apical 80% Basolateral 60% * 40% * 20% 0% WT * Y28 6A LSYTRF F52dup L90V Cell line WT Apical Basolateral FEBS Journal 276 ( 200 9) 6992 700 5 ê 200 9 The Authors Journal compilation ... containing b-mercaptoethanol and dithiothreitol for 10 700 2 to strip off protein Then the samples were centrifuged for 10 at high speed at C All of the supernatant (containing the protein) was then...

14
433
0

Báo cáo sinh học: " Functional relevance of nonsynonymous mutations in the HIV-1 tat gene within an epidemiologically-linked transmission cohort" pot

Danh mục: Hóa học - Dầu khí

... of Tat, the trans-activator of HIV -1, defined by mutational analysis Nucleic Acids Res 19 89, 17 (9):35 51- 35 61 The authors wish to thank Meriet Mikhail for assistance in generating the tat amplicons ... transactivation (the SF2 clone of one-exon tat) The values at the bases of the columns indicate the number of times that particular Tat amino acid sequence was scored in the entire sample set An ... identical to clone A1 -1 with the remaining two clones identified as clones A5 -4 and A5 -5 The data identify dominant tat clones present in all three individuals: clone A1 -1 for donor A, clone B2-1...

5
317
0

báo cáo hóa học: " Endotoxin-induced cytokine and chemokine expression in the HIV-1 transgenic rat" docx

Danh mục: Toán học

... Institutional Animal Care and Use Committee; IFN-β: Interferon beta; IFN-γ: Interferon Gamma; IL - 10 : Interleukin 10 ; IL - 10 rα: Interleukin 10 receptor, alpha; IL -11 : Interleukin 11 ; IL -12 : Interleukin 12 ; ... Ivashkiv LB: IFN-gamma abrogates endotoxin tolerance by facilitating Toll-like receptorinduced chromatin remodeling Proc Natl Acad Sci U S A 2 01 0 , 10 7 :19 438 -19 443 Mahajan SD, Schwartz SA, Shanahan ... -2 .1 Interleukin 17 B Interferon gamma Integrin alpha M Integrin beta Lymphotoxin alpha (TNF superfamily, member 1) -2.5 12 .7 Interleukin 18 Ltb -2 .0 -12 .0 3.4 Lta 19 .9 -19 .9 Interleukin 13 Il15...

32
427
0

Báo cáo hóa học: " Functional relevance of nonsynonymous mutations in the HIV-1 tat gene within an epidemiologically-linked transmission cohort" pot

Danh mục: Hóa học - Dầu khí

... of Tat, the trans-activator of HIV -1, defined by mutational analysis Nucleic Acids Res 19 89, 17 (9):35 51- 35 61 The authors wish to thank Meriet Mikhail for assistance in generating the tat amplicons ... transactivation (the SF2 clone of one-exon tat) The values at the bases of the columns indicate the number of times that particular Tat amino acid sequence was scored in the entire sample set An ... identical to clone A1 -1 with the remaining two clones identified as clones A5 -4 and A5 -5 The data identify dominant tat clones present in all three individuals: clone A1 -1 for donor A, clone B2-1...

5
268
0

Unit 8_ LIFE IN THE FUTURE_Test 1.doc

Danh mục: Tư liệu khác

... eating healthy, and helping build a healthier society by shopping at better stores that sell better food Most people will be aware that a happy, loving family is a joy to be part of, and that ... Education b Genetic Engineering c Computers d Family 38 The phrase to have a Miss World appearance means that _ a to become a Miss World b to enter a beauty contest c to be intelligent d to be ... will then be able to create a machine duplicate of ourselves (44) _ we will appear to be alive long after we are dead Maybe a few decades later, a way will be found to transfer our spirit, including...

7
12,396
208

Salt stress in the plant 1 pot

Danh mục: Nông nghiệp

... -GCTTTTGGAATAGCATCAGTCTTGTGGC- 30 50 -CCGTCAAAACTCCAGAAACATCAACTCCTT- 30 Gene cloning Gene cloning qRT-PCR qRT-PCR 52 .0 °C / 10 74 bp 50 -ATHAARAAGYTTTACTTTGGMAGGCAC- 30 50 -ACAGCTCCTCKCATRAGHCCAGCCCAC- 30 50 ... °C/ 508 bp 50 -CCTGATTATATGGTAGTTTGGCTGTGGA- 30 50 -TACAGGCAACAGTTTTACACAAATCACAT- 30 qRT-PCR qRT-PCR 62 .0 °C/ 217 bp 50 -GAAGGGGAGTCGCTGATGAATGATGG- 30 50 -TTGDDKATYCKBCCCTCWTYRAGCAT- 30 50 -GCTTTTGGAATAGCATCAGTCTTGTGGC- 30 ... 18 .39 ± 0. 78c 19 .95 ± 1. 34b 0. 92 ± 0 . 10 c 25. 71 ± 3.37b 34.79 ± 2.4 4a 0. 74 ± 0 .11 b 44. 70 ± 1. 1 3a 11 .36 ± 0. 51c 3.93 ± 0. 3 2a 58. 41 ± 1. 5 8a 14 .92 ± 1. 14c 3. 91 ± 0. 0 7a 64.38 ± 1. 8 4a 10 .00 ± 1. 45c 6.44...

16
444
0

Báo cáo toán học: "Graphs with chromatic roots in the interval (1, 2)" doc

Danh mục: Báo cáo khoa học

... 1. 95 31 1.9 611 1. 96 60 1. 9696 1. 9722 1. 9743 15 1. 9568 1. 96 40 1. 9685 1. 9 717 1. 97 41 1.97 61 1.9777 17 1. 9599 1. 9665 1. 9 706 1. 9735 1. 9757 1. 9775 1. 97 90 1. 9 802 19 1. 9625 1. 9685 1. 9723 1. 97 51 1.97 71 1.9788 ... 1. 9788 1. 98 01 1.9 813 1. 9822 Table 1: Chromatic root of X(s, t) to decimal places s\t 11 13 15 17 19 1. 913 1 1. 9294 1. 94 20 1. 9397 1. 9 500 1. 9566 1. 9468 1. 9556 1. 9 613 1. 9653 11 1. 95 21 1.9598 1. 9648 1. 9684 ... 1. 9684 1. 9 711 13 1. 9563 1. 96 31 1.9676 1. 9 708 1. 9733 1. 9752 15 1. 9596 1. 9659 1. 9699 1. 9728 1. 97 51 1.9768 1. 9783 17 1. 9624 1. 96 81 1.9 718 1. 9745 1. 9766 1. 9782 1. 9796 1. 9 807 19 1. 9648 1. 9 700 1. 9734 1. 9759...

7
336
0

Báo cáo y học: " Alarms in the intensive care unit: how can the number of false alarms be reduced" doc

Danh mục: Báo cáo khoa học

... AJ, Woods LA, Raney D, Bredle DL: Name that tone: the proliferation of alarms in the intensive care unit Chest 19 94, 10 5 :12 17 12 20 Koski EM, Maakivirta A, Sukuvaara T, Kari A: Clinician’s opinions ... significance of the alarm for the patient remains as the major difficulty commentary units have been conducted to examine the relevance of alarms in monitoring; they showed that less than 10 % of alarms ... deteriorating Different approaches have been used to improve the situation Critical Care August 20 01 Vol No Chambrin Table Classification of alarms according to the existing standards Type of alarm...

5
272
0