0

quantitative antibodies used arrays are incomplete for entire protein complement epitopes lie in different segments of a peptide and may not be represented on the array

Expression dynamics of the hepatic mitochondrial proteome of the sod2+  mouse in response to troglitazone administration

Expression dynamics of the hepatic mitochondrial proteome of the sod2+ mouse in response to troglitazone administration

Tổng hợp

... 8-oxo-hydrodeoxyguanosine Alanine aminotransferase Asparate aminotransferase Area under curve Carbonate radical anion Chromatin Immunoprecipitation Database for Annotation, Visualization and Integrated Discovery ... protein- chipbased arrays There are advantages and disadvantages to both platforms and they are listed in Table Due to the numerous facets of protein characteristics that make up a proteome, complementary ... Simvastatin Sulindac Stavudine Anti-aginal Statinc NSAID NSAID Tolcapone Troglitazone Parkinson’s Diabetes Trovafloxacin Valproic acid Antibiotics Antiepileptic Fromenty et al (1990); Berson et al...
  • 226
  • 1,830
  • 0
phrasal verbs followed by the -ing form

phrasal verbs followed by the -ing form

Ngữ pháp tiếng Anh

... go on information, you are able to continue an investigation or other project because you have this information The detective said he needs more to go on and asked the public for information The ... think ahead think ahead S thinks ahead -ing form past tense past participle thinking ahead thought ahead thought ahead think ahead p.v When you think ahead, you plan fora future situation or activity ... for the bus Bob's been hanging around the house all day Doesn't he have anything to do? hang around p.v [informal] When people stay in a place instead of leaving, they hang around What's the...
  • 16
  • 741
  • 0
Báo cáo y học:

Báo cáo y học: " Enteritis caused by Campylobacter jejuni followed by acute motor axonal neuropathy: a case report" pptx

Báo cáo khoa học

... [7] There is a lack of evidence on the prevalence of C jejuni in many geographical areas including Serbia as a triggering organism in the etiology of GBS and other post-infectious sequelae In addition, ... days after the onset of the campylobacter infection C jejuni was recovered in the sample taken on day 31 after the onset of diarrheal disease Further excretion of microorganisms was not examined ... reports on the prevalence and characterization of thermophilic campylobacter strains isolated from all over the world are yet to be combined globally for research purposes The characterization of thermophilic...
  • 4
  • 351
  • 0
40185 prepositional verbs followed by the gerund

40185 prepositional verbs followed by the gerund

Anh ngữ cho trẻ em

... what you wanted to Writers cannot rely their (share) _ a common context to interpret the other's casual, compact or cryptic speech If you usually keep your windows/doors open, then count ... usually keep your windows/doors open, then count (change) the air filter every month We all agree _ your (open) _ the discussion ...
  • 2
  • 317
  • 0
Tài liệu Báo cáo khoa học: Perturbation of membranes by the amyloid b-peptide – a molecular dynamics study pptx

Tài liệu Báo cáo khoa học: Perturbation of membranes by the amyloid b-peptide – a molecular dynamics study pptx

Báo cáo khoa học

... running averages of the data are shown, using a window of ten data points designation In the case of simulation A1 , the area per lipid headgroup is largely constant at the outset of the ˚ simulation, ... behavior arises as a result of the tilt of the peptide and interactions between the embedded region of the peptide and the acyl chains, it presents an interesting insight into the interactions between ... Fig Area per lipid headgroup as a function of time for control DPPC simulations Fig Area per lipid headgroup as a function of distance from the protein; simulations A1 and A2 are shown at each of...
  • 16
  • 475
  • 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

Báo cáo khoa học

... Beauchamp and Fridovich [42] Protein concentration Estimation of the concentration of purified protein or in the lysates was by the method of Bradford using BSA as standard [43] Protection against ... Superposition was calculated using the combinatorial extension method to maximize backbone contacts [42] Labels indicate the positions of the N- and C-termini, the iron ion and residues Q69 and A1 41 in ... We are indebted to G Peplow, F Yamakura and T Matsumoto for the analyses of iron and manganese in protein samples We also wish to thank H Steinman for the gift of E coli OX32 6A We finally thank...
  • 12
  • 740
  • 0
Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx

Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx

Báo cáo khoa học

... 5¢-AATTTGGGCGCGGGCCGCGA AAGTAACCGGAAT-3¢ for E19 0A, 5¢-CAAATTGGGGG CCCAGCAGCTGGGAAGTCTGAA-3¢ and 5¢-TTCAGA CTTCCCAGCTGCTGGGCCCCCAATTTG-3¢ for E19 9A, and 5¢-GAAGCTGGGAAGTCTGCACAGTCTGGAGCC AAG-3¢ and ... chains of insulin, resulting in the aggregation and precipitation of the B chain Reduction stress assays are advantageous over thermal stress assays as they can be performed at physiological ... C-terminal extension, i.e E19 0A, E19 9A and E20 4A An additional mutant, Q19 4A, was also prepared and included as a control The role of the C-terminal extension and each of the mutated residues was investigated...
  • 14
  • 417
  • 0
Báo cáo khoa học: Phosphorylation of the Saccharomyces cerevisiae Grx4p glutaredoxin by the Bud32p kinase unveils a novel signaling pathway involving Sch9p, a yeast member of the Akt / PKB subfamily pot

Báo cáo khoa học: Phosphorylation of the Saccharomyces cerevisiae Grx4p glutaredoxin by the Bud32p kinase unveils a novel signaling pathway involving Sch9p, a yeast member of the Akt / PKB subfamily pot

Báo cáo khoa học

... mutation Yeast strains were grown in noninducing raffinose medium to exponential phase, and then incubated for 30 in galactose medium to activate the GAL regulon Total mRNAs were extracted and ... phase Cells were routinely incubated at 28 °C Construction of mutant yeast strains Standard DNA manipulation was performed as described in [32] Gene deletions and C-terminal epitope-tagging of ... and the signal was quantified on a Kodak Image Station 440CF and analyzed with Kodak 1d image software Monoclonal antibodies against phosphoserine (cat no P3430) (anti-pSer), polyhistidine (cat...
  • 15
  • 414
  • 0
Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt

Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt

Báo cáo khoa học

... Functional study of crustacean neuropeptide S H.-K Tiu and S.-M Chan in the stimulation of gonad maturation Injection of protein extract from thoracic ganglion or the brain can stimulate gonad maturation ... and 5A) In conclusion, the use of recombinant protein or RNAi alone may not be sufficient to confirm the function of a neuropeptide The combined use of recombinant protein and RNAi described in this ... cause a decrease in total ovary protein incorporation, and suppress ovary total protein synthesis [11,17,18] Biological assays using these criteria are nonspecific and provide little information...
  • 11
  • 546
  • 0
Báo cáo khoa học: Variants of b2-microglobulin cleaved at lysine-58 retain the main conformational features of the native protein but are more conformationally heterogeneous and unstable at physiological temperature potx

Báo cáo khoa học: Variants of b2-microglobulin cleaved at lysine-58 retain the main conformational features of the native protein but are more conformationally heterogeneous and unstable at physiological temperature potx

Báo cáo khoa học

... It has become clear that this compact, seven b-stranded protein is conformationally unstable after cleavages and truncations, and that even intact b2m may, to a minor extent, adopt an alternative ... contained 0.2 mgÆmL)1 of a marker peptide Shown are the summed peak areas P (total area of f + s peaks) divided by the marker peak area M at different time points as a percentage of the initial value ... high-concentration samples and s injections of low-concentration samples) were analyzed by CE performed at constant current of 80 lA, with the capillary cooling fluid maintained at 278 K Samples also contained...
  • 14
  • 358
  • 0
Báo cáo khoa học: The phosphatidylethanolamine level of yeast mitochondria is affected by the mitochondrial components Oxa1p and Yme1p ppt

Báo cáo khoa học: The phosphatidylethanolamine level of yeast mitochondria is affected by the mitochondrial components Oxa1p and Yme1p ppt

Báo cáo khoa học

... GTTCACGTACAAGCGGAGCCACAGAATAACCTCCCCGACGCGGATCCCCGGGTTAATTAA GTTTTATATTTTTATATTTACAGAGAGATATAGAGCCTTTATGAATTCGAGCTCGTTTAAAC GCCAGTTAAGAACGCCTTGGCGCAAGGGAGGACGCTCCTCCGGATCCCCGGGTTAATTAA CAGGTATGTGGTTCCAAGTGTTTGTCGCTCTTTGAATTTGGAATTCGAGCTCGTTTAAAC ... CAGGTATGTGGTTCCAAGTGTTTGTCGCTCTTTGAATTTGGAATTCGAGCTCGTTTAAAC TCTAATACGACTCACTATAGGGAGAATGTCAATTATGCCAGTTAAG CTTTACATATGATTGCTTTCATTTTAAATCATTCTTTCC AGAACTGCGGTGCTATGGAATAGA TTTGGCACGATCCACAATCTC an overnight culture and cells ... decreased transcription rate for PSD1 and a defect in Psd1p maturation are the molecular basis of the decreased rate of PtdSer decarboxylation in oxa1D mitochondria One obvious explanation for the...
  • 11
  • 354
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" pdf

Báo cáo khoa học

... is the band gap energy of the bulk semiconductor The n value is for indirect-gap materials Values of the optical band gap for the samples were obtained by the extrapolation of the linear region ... could be explained by insufficient surface passivation, leading to aggregate formation [28] The dimensions of SnS NCs were in a range of 5–200 nm depending on synthetic conditions Fast nucleation and ... oleylamine/oleic acid mixture The presence of oleic acid in the reaction mixture serves as a ligand and also plays a vital role in the formation of nanoscale tin sulfide by controlling the reactivity of precursors...
  • 5
  • 365
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" ppt

Báo cáo khoa học

... is the band gap energy of the bulk semiconductor The n value is for indirect-gap materials Values of the optical band gap for the samples were obtained by the extrapolation of the linear region ... could be explained by insufficient surface passivation, leading to aggregate formation [28] The dimensions of SnS NCs were in a range of 5–200 nm depending on synthetic conditions Fast nucleation and ... oleylamine/oleic acid mixture The presence of oleic acid in the reaction mixture serves as a ligand and also plays a vital role in the formation of nanoscale tin sulfide by controlling the reactivity of precursors...
  • 5
  • 276
  • 0
Báo cáo y học:

Báo cáo y học: "Diabetic ketoacidosis complicated by the use of ecstasy: a case report" ppsx

Báo cáo khoa học

... strenuously They showed good clinical evolution after fluid replacement and the administration of insulin, although one of the patients developed bronchopneumonia and needed intubation and mechanical ... discontinue ecstasy use, despite their being made aware of the potential risk of this drug The woman in our case was not aware of the side effects of ecstasy We believe that improved screening and ... (elevated heart rate and arterial blood pressure); exacerbation of anxiety; and activation Page of of the hypothalamic-pituitary-adrenal axis The most frequently reported side effects are arrhythmias,...
  • 3
  • 399
  • 0
Báo cáo y học:

Báo cáo y học: "Diabetic ketoacidosis complicated by the use of ecstasy: a case report." docx

Báo cáo khoa học

... strenuously They showed good clinical evolution after fluid replacement and the administration of insulin, although one of the patients developed bronchopneumonia and needed intubation and mechanical ... discontinue ecstasy use, despite their being made aware of the potential risk of this drug The woman in our case was not aware of the side effects of ecstasy We believe that improved screening and ... (elevated heart rate and arterial blood pressure); exacerbation of anxiety; and activation Page of of the hypothalamic-pituitary-adrenal axis The most frequently reported side effects are arrhythmias,...
  • 3
  • 327
  • 0
Báo cáo y học:

Báo cáo y học: "Inhibition of NFκB by the natural product Withaferin A in cellular models of Cystic Fibrosis inflammation" pps

Báo cáo khoa học

... attracted to the site of infection and these cells release proteases and other agents that cause structural damage to the airways Anti-inflammatory agents are used to manage lung inflammation in CF, ... http://www.journal-inflammation.com/content/6/1/15 Figure inhibition by WFA Quantification of p65 translocation upon PAF stimulation and Quantification of p65 translocation upon PAF stimulation and inhibition by WFA Quantification ... supplement conventional therapies [23] We are intrigued by this finding, as there are many promising anti-inflammatory and anti-bacterial ethnopharmacological agents that have not been adequately studied...
  • 5
  • 306
  • 0
A study on the structure of the speech “ I have a dream” by Martin Luther King A systemic functional grammar analysis

A study on the structure of the speech “ I have a dream” by Martin Luther King A systemic functional grammar analysis

Tổng hợp

... Functionalists, on the other hand, hold the belief that “Grammar should be seen as facilitating communication in all modes, not as an isolated area of study” (G Lock, 1996) As having the experience ... my notion of its applications in language teaching and learning becomes Hence, I decided to conduct a study on the structure and meaning of the speech “I have a dream” by Martin Luther King - a ... functional grammar analysis based on Halliday’s functional grammar as the theoretical framework 1.2 Aims of the study In carrying out the research, the writer aims to:  Illustrate the key concepts...
  • 4
  • 676
  • 5
Tài liệu Protein Data Bank Contents Guide: Atomic Coordinate Entry Format Description Version 3.20 Document Published by the wwPDB ppt

Tài liệu Protein Data Bank Contents Guide: Atomic Coordinate Entry Format Description Version 3.20 Document Published by the wwPDB ppt

Ngân hàng - Tín dụng

... that in AUTHOR by leaving no leading blank in column 20 of any continuation lines * One author's name, consisting of the initials and family name, cannot be split across two lines If there are ... coordinates HETNAM Optional Mandatory if a non-standard group other than water appears in the coordinates HETSYN Optional FORMUL Optional HELIX Optional SHEET Optional SSBOND Optional Mandatory if a disulfide ... P atoms only AUTHOR Mandatory REVDAT Mandatory SPRSDE Optional Mandatory for a replacement entry JRNL Optional Mandatory for a publication describes the experiment REMARK Optional Mandatory for...
  • 205
  • 387
  • 0
Tài liệu Báo cáo khoa học: Mitochondrial chaperone tumour necrosis factor receptor-associated protein 1 protects cardiomyocytes from hypoxic injury by regulating mitochondrial permeability transition pore opening docx

Tài liệu Báo cáo khoa học: Mitochondrial chaperone tumour necrosis factor receptor-associated protein 1 protects cardiomyocytes from hypoxic injury by regulating mitochondrial permeability transition pore opening docx

Báo cáo khoa học

... against rat TRAP1 was 5¢-CAACAGAGATTGATCAA AT-3¢ A negative control adenovirus vector containing nonspecific siRNA was constructed in the same way (nonspecific vector, 5¢-TTCTCCGAACGTGTCACGT-3¢) All ... conditions in cardiomyocytes In tumour cells, TRAP1 interacts with CypD, and the association of TRAP1 with CypD is prevented by CsA and not geldanamycin, suggesting that this association may be ... increase remains unclear The question remains as to whether the hypoxia-induced TRAP1 increase is a protective reaction in cardiomyocytes Because TRAP1 is a mitochondrial chaperone, it has an important...
  • 10
  • 507
  • 0
Tài liệu Báo cáo khoa học: Regulators of G-protein signalling are modulated by bacterial lipopeptides and lipopolysaccharide pptx

Tài liệu Báo cáo khoa học: Regulators of G-protein signalling are modulated by bacterial lipopeptides and lipopolysaccharide pptx

Báo cáo khoa học

... stimulation of distinct TLR pathways different MAP kinases and several transcription factors like Nf-jB are activated and the induction of proinflammatory cytokines are found [38] The participation ... That means that upregulation of RGS1 mRNA may lead to modulation of cyclo-oxygenase-2 transcription involved in inflammation [34] Another surprising point was the strong upregulation of RGS1 and ... release of different in ammatory mediators Stimulation of TLR leads to activation of a series of signalling proteins, and to the expression of pro- and in ammatory cytokines There is evidence that...
  • 11
  • 569
  • 0

Xem thêm