purification of rnap using polymin p dna cellulose and a1 5m chromatography

Báo cáo khoa học: Constitutive expression of the human peroxiredoxin V gene contributes to protection of the genome from oxidative DNA lesions and to suppression of transcription of noncoding DNA pdf

Ngày tải lên : 30/03/2014, 11:20

... GC, 0.65 ratio ObsCpG ⁄ ExpCpG, 500-bp length, 100-bp gap between adjacent islands) Acknowledgements This research was supported in part by Philip Morris USA Inc and by Philip Morris International ... NRF2 expression does not depend on PRDX5 It appears therefore that inhibition of PRDX5 by CSE can be explained by a CSE-induced decrease in NRF2 (Fig 3C,D) Role of PRDX5 in suppression of DNA oxidation ... corresponding DNA fragment was PCR-ampliﬁed from a plasmid with full PRDX5 cDNA using primers BE-1 (GGCGGATCCATGG GACTAGCTGGCGTGTGCG) and BE-2 (GGCGA ATTCTTATCAGAGCTGTGAGATGATATTGGG) and DNA polymerase PfuI...

11
463
0

Báo cáo lâm nghiệp: "Direct effects of acidic wet deposition on photosynthesis and stomatal conductance of two Populus clones (P. cv. Beaupré and P. cv. Robusta" pot

Ngày tải lên : 09/08/2014, 04:20

... surements of upper and lower leaf surfaces (Fig 2) For both clones and treatments, g shows its maximal value on sat s fully expanded leaves The optimal leaf ages were LPI for cv Beaupr6 and LPI 12 ... Freer-Smith P. H (1984) The responses of six broadleaved trees during long-term exposure to S0 and N0 New Phytol 97, 49-61 Steenackers V (1982) Selectie van populieren voor biomassaproduktie In: Produktie ... en Landbouw (Brussels, Belgium) References Discussion and Conclusions Ceulemans R., Kockelbergh F & Impens (1986) A fast, low cost and low power requiring device for improving closed loop C0...

4
160
0

Báo cáo sinh học: "Development of avian influenza virus H5 DNA vaccine and MDP-1 gene of Mycobacterium bovis as genetic adjuvant" pptx

Ngày tải lên : 14/08/2014, 19:22

... different DNA vaccines Band of the expected size (141 bp) for H5 in groups immunized with H5 and H5 + MDP1; and band of expected size (196 bp) in groups immunized with MDP1 and H5 + MDP1 was detected, ... MDP1 gene into the pcDNA3.1 + vector The constructed pcDNA3.1/H5 and pcDNA3.1/MDP1 were transformed into TOP10F' Escherichia coli and the positive clones were screened using PCR, RE analysis and ... School of Medicine, Osaka, Japan; was amplified from pcDNA3.1/MDP1 using forward and reverse primers with HindIII and BamHI sites, respectively (Table 1) The amplified genes of H5 and MDP1 were...

9
275
0

Investigation of the adsorption of biomolecules using surface plasmon fluorescence spectroscopy and microscopy

Ngày tải lên : 08/11/2015, 17:01

... of SPFS (spectroscopy), SPFM (microscopy), SPFS (spectrometry) and the influence of surface plasmon fields on fluorophores close to planar surfaces is discussed in part The use of SPFS and SPFM ... focuses on the development of surface plasmon enhanced fluorescence spectroscopy (SPFS) and microscopy (SPFM) and their potential application in the field of biosensor The aims of this study are ... chopper PC motorsteering lock-in amplifier Fig.3.1: Schematic diagram of Surface Plasmon Spectroscopy (SPS) setup 27 In the following, some experimental issues of surface plasmon spectroscopy...

83
164
0

Preparative isolation and purification of six volatile compounds from essential oil of Curcuma wenyujin using high-performance centrifugal partition chromatography doc

Ngày tải lên : 07/03/2014, 21:20

... Germany), equipped with HPCPC to pump Maximum sample injection volume was mL and the flow rate of the pump was set between and 30 mL/min Maximum pressure of the HPCPC equipment is 6.0 MPa An ultra-violet ... the mobile phase in the present HPCPC separation The upper stationary phase was first pumped into HPCPC at a flow-rate of 5.0 mL/min and the apparatus was run at 300 rpm under ascending separation ... the optimized solvent system used for HPCPC separation 2.4 HPCPC separation procedure The upper phase of the two-phase solvent system was performed as the stationary phase and the lower phase...

7
502
0

Báo cáo khoa học: Using directed evolution to improve the solubility of the C-terminal domain of Escherichia coli aminopeptidase P Implications for metal binding and protein stability pptx

Ngày tải lên : 23/03/2014, 07:20

... aminopeptidase P N-domain 174 C-domain J.-W Liu et al 439 439 157 212 439 AMPP wt AMPP #2 A kDa M S S S S P P P P 97.4 66.2 AMPP #12 45.0 157 R166G G270V E406G 439 G270V E406G 439 AMPP #3-22 31.0 172 AMPP ... Authors Journal compilation ª 2007 FEBS 4745 C-terminal domain of E coli aminopeptidase P - Mn Zn Co Cu J.-W Liu et al Fe AMPP wt AMPP #2 AMPP #3-22 Fig In vitro refolding of AMPP and its C-terminal ... fragment was expressed and assayed for solubility From an inspection of Fig 2, it appeared that E coli produced more soluble AMPP#4-3 than AMPP#3-22 Whether AMPP#4-3 was more soluble than AMPP#3-22 was...

10
538
0

Báo cáo khoa học: "Expression of Angiostatin Using DNA - Based Semliki Forest Virus Replicon" pptx

Ngày tải lên : 07/08/2014, 15:20

... was performed using the pcSFV/Agt as the template with the same primers Amplified DNA fragments were filled in by using Klenow fragment (TaKaRa) pCI-neo (Promega) was digested with Sma I and dephosphorylated ... conversion of alphavirusderived replicon into a plasmid DNA- based expression system is the primary requisite step toward the development of the alphavirus-based gene transfer systems which parallel ... cancer and other angiogenesis-related diseases The most direct approach is the large-scale preparation of this recombinant angiostatin protein Several approaches are under development to apply this...

5
239
0

Báo cáo y học: "Effective detection of rare variants in pooled DNA samples using Cross-pool tailcurve analysis" ppsx

Ngày tải lên : 09/08/2014, 23:20

... = (TP x TN – FP x FN) / SQRT [(TP + FP) x (TP + FN) x (TN + FP) x (TN + FN)] Sensitivity (True Positive Rate, Recall): TP / (TP + FN) Specificity (True Negative Rate): TN / (FP + TN) PPV (Precision): ... each pool (80) and known dbSNP positions as primary input parameters SERVIC4E was run using a trim value of 25 and a total allele number of 80 All other parameters were run at default The focus of ... TP / (TP + FP) NPV: TN / (TN + FN) Accuracy: (TP + TN) / (TP + TN + FP + FN) FPR (Fall-out): 1- TNR FDR: FP / (FP + TP) Abbreviations cq- consensus quality score generated by SAMtools pileup;...

51
410
0

Báo cáo y học: " Measurement of Epstein-Barr virus DNA load using a novel quantification standard containing two EBV DNA targets and SYBR Green I dye" pps

Ngày tải lên : 12/08/2014, 01:22

... copies/ml However, 50% of these samples were below 2.0 × 103 copies/ml EBV detection and load in the population sample EBNA-1 and BHRF-1 DNA were detected in 11.0% and 21.6% of Group (the population ... sample), respectively; 22.5% of samples were positive for at least one EBV DNA target (Table 4) Of the 24 EBNA-1 DNA positive samples, 91.7% were also BHRF-1 DNA positive, and of the 47 BHRF-1 DNA ... EBNA-1 DNA and BHRF-1 DNA were identified on agarose gel by 213 bp and 208 bp bands, respectively Reproducibility studies consisting of triplicates of each standard curve dilution (101 -105 copies/5...

11
323
0

Báo cáo y học: "Characterizing the expression of the human olfactory receptor gene family using a novel DNA microarray" pps

Ngày tải lên : 14/08/2014, 07:21

... base-pair (bp) OBP2B product was only amplified from the olfactory epithelium samples (b) The 562 bp cathepsin C (CTSC) product was successfully amplified from all three samples Both primer pairs ... designed to amplify multiple exon products and hence are expected to yield a much larger product (1,686 bp) if genomic DNA was used as template (c) The 378 bp product of the OMP gene was amplified ... Yang Z: PAML: a program package for phylogenetic analysis by maximum likelihood Comput Appl Biosci 1997, 13:555-556 Eisen MB, Spellman PT, Brown PO, Botstein D: Cluster analysis and display of genome-wide...

10
261
0

Báo cáo y học: "Effects of p-Synephrine alone and in Combination with Selected Bioflavonoids on Resting Metabolism, Blood Pressure, Heart Rate and Self-Reported Mood Changes"

Ngày tải lên : 25/10/2012, 11:04

... response to p- synephrine or p- synephrine in combination with naringin and hesperidin (Table 2) p- Synephrine differs from ephedrine in that it has a hydroxyl group on the para position of the benzene ... randomized double-blinded placebo control pilot study supports the safety and thermogenic effects of p- synephrine, particularly when combined with 600 mg of naringin and 100 mg of hesperidin No increase ... PPARα [32], a major regulator of lipid metabolism in the liver Products with thermogenic properties are frequently associated with elevated blood pressures and heart-rates p- Synephrine is a phenylethylamine...

7
641
0

Báo cáo y học: "Allele dependent silencing of COL1A2 using small interfering RNAs"

Ngày tải lên : 03/11/2012, 11:52

... SNP With a panel of siRNAs against common SNPs in the Collagen type I genes it would be possible to genotype the patient for common polymorphic positions and then advance with the most appropriate ... aimed at exploring a genetic therapeutic approach for treating or limiting the severity of this disease The principle of allele specific silencing of Collagen type I genes has been explored previously ... who reported allele-preferential silencing of COL 1A1 in COS7 cells and in primary human mesenchymal progenitor cells The results reported by Millington-Ward can be regarded as proof of principle...

5
465
0

Using information technology in teaching and learning reading skill of english for biology for 2nd-year students

Ngày tải lên : 07/11/2012, 14:31

... ESP teaching and learning and (3) advantages of using computers in reading ESP teaching and learning I.2.3.1.1.Model of teaching ESP reading with computers Some models of using computers in teaching ... Which form of the presentation of an ESP reading lesson applied by the teacher you prefer to study? A A lesson with a blackboard and pieces of chalk B A lesson with a computer and a LCD projector ... (2) computers and ESP I.2.2 Computers in academic setting Computers with Internet and word processing programmes have been used for searching, selecting and preparing materials in teaching and learning...

43
1.4K
6

Increasing energy efficiency of HVAC systems of buildings using phase change material

Ngày tải lên : 05/09/2013, 15:28

... for Cases and with the two types of PCM layer Figure 16 shows the average volume temperature and control point temperature for Cases and with two types of PCM layers ISSN 2076-2895 (Print), ISSN ... For the PCM simulations a PCM layers was added between the air and plastic shade in the external wall Table shows the PCM thickness and properties Table Phase change material (PCM) properties ... Journal of Energy and Environment (IJEE), Volume 3, Issue 5, 2012, pp.667-686 685 [15] Muruganantham K., Phelan P. , Horwath P. , Ludlam D., McDonald T., Experimental Investigation of a Bio-Based Phase...

20
405
0

Production of hydrogen using composite membrane in PEM water electrolysis

Ngày tải lên : 05/09/2013, 16:11

... experiment is purified by reverse osmosis (Millipore Milli Q equipment) Thus obtained pure water is supplied from water reservoir atop and supplied on the both sides of the single cell The produced ... water and for the free flow of produced gases during electrolysis operation [18] The testing of the prepared MEA (fixed in single cell) is operated in electrolysis mode at atm pressure and temperatures ... strong absorption centered at 710.55 cm-1 is the typical Ti-O-Ti vibration [21-23] The characteristic peak of – SO3- group of Nafion of 1240 and 1132 cm-1.Moreover the adsorption band of Nafion...

8
499
0

A study on differences of using pasive voi in english and vietnamese = nghiên cứu về sự khác nhau trong cách dùng câu bị động của tiếng anh và tiếng việt luận văn tốt nghiệp đại học

Ngày tải lên : 18/12/2013, 10:03

... having been plus past participle Eg: He hated being made fun of in public We form the passive with a form of be and a past participle The past participle does not necessarily refer to past time ... time For regular and irregular past participle rules applying to use of tenses in active apply in the passive For example, 14 an action in progress now requires the present progressive Your steak ... say mụi thuục ma APPENDIX 13 KINDS OF PASSIVE VOICE CORRESPONDING WITH 13 TENSES Tense Structure Example Simple Present Am/ is/ are + Past Participle (P. P) He is taken to the zoo Present Continuous...

46
1.4K
6

Tài liệu Activity 7.2: Determining the Impact of Technology on a Windows DNA Design docx

Ngày tải lên : 21/12/2013, 06:16

... 7.2: Determining the Impact of Technology on a Windows DNA Design Exercise 1: Determining Technology Implications ! Determine technology implications Participate in small groups as assigned by the ... level of impact — high, medium, or low — that each technology type would have on the given layer of a Windows DNA design Write your answers in the grid provided After completing the above steps, ... responses with the class The instructor will write the class consensus on a flip chart Use the space below for brainstorming Activity 7.2: Determining the Impact of Technology on a Windows DNA...

4
631
0

Tài liệu Báo cáo khoa học: N-Methyl-L-amino acid dehydrogenase from Pseudomonas putida A novel member of an unusual NAD(P)-dependent oxidoreductase superfamily ppt

Ngày tải lên : 19/02/2014, 16:20

... 0.066% by purication steps with such chromatography columns as SuperQ-Toyopearl, Butyl-Toyopearl, DEAE-Toyopearl, Green-Sepharose, RESOURCE PHE, and Blue-Sepharose SDS PAGE analysis and a TLC-based ... named dpkA, from P putida ATCC12633 was obtained by PCR with primers designed on the basis of sequences of PP3591 from P putida KT2440 The nucleotide sequence of the cloned gene (1026 bp; 341 ... sequences of the gene showed high identities (97.9% and 99.1%, respectively) with those of the PP3591 gene of P putida KT2440 Results and Discussion Purication and subunit structure of NMAADH...

7
518
0

Tài liệu Báo cáo khoa học: "Modeling Wisdom of Crowds Using Latent Mixture of Discriminative Experts" docx

Ngày tải lên : 20/02/2014, 05:20

... Listener9 pause POS:NN pause pause pause POS:NN Eyebrow up eye gaze lowness label:sub pause POS:NN POS:NN dirdist:L1 pause dirdist:L8+ dirdist:R1 eye gaze POS:NN label:pmod label:nmod low pitch low pitch ... downslope in pitch, pitch regions lower than 26th percentile, drop/rise and fast drop/rise in energy of speech, vowel volume, pause racy, with the exception of features that require dependency ... analysis suggests three prototypical patterns For the ﬁrst listeners, pause in speech and syntac1 http://rapport.ict.usc.edu/ 337 Computational Model: Wisdom-LMDE The goals of our computational model...

6
346
0