... imposing a radially-oscillating or axially-oscillating wave on atube wall subjected to apulsatile incoming flowA linear analytical approach was first developed to study a radially-oscillating axisymmetric ... effects, and rheological properties of blood (Dooren 1978; Jayaraman et al 1983; Jain and Jayaraman 1990) Among such studies, Ramachandra Rao (1983) presented an analytical work on the pulsatileflow ... radially and to a smaller extent, axially In massage therapy, either by hand or mechanical devices, the artery wall is compressed and the resulting constriction may move radially and axially In...
... virgin females was in line with AMADA Y (1974), who showed that the genetic correlation between the egg laying of ROZCO virgin and fecund females was 0.8, and O & BELL (1974), who showed that » in ... production in representatives of three wild populations of Tribolium castaneum in Israel (Jaffa, Rehovot and Beer-Sheva) In each population two selection lines HR (High Responsiveness) and LR (Low Responsiveness) ... 1975), final height and flowering time in Nicotiana rustica (P & JINKS, ERKINS RUMPTON 1968, 1971, 1973 ; B et al., 1977 ; JINKS et al., 1977 ; BOUGHEY & JINKS, 1978), and egg production in Tribolium...
... CCCAAGAAAGATGGCTGGAA GGCAGGTCAGGTCAACAACA CGATGGCGTTTTTGAACAGAG CATCCAAGAAGCTTTCCTCAATCT AGTCAGAAATGCCTGCAAAAAGA TTCCTTGCCATGCGCGATCCC CGGATGTTGTGGAAAAACGA TACGGTGGTGACAGCGGATAGG GGTGACTAAGAAAGATGAGGCGA ... AGGTCATCACCATTGGCAATG GGGAAGCTTACTGGAATGGCT GCTACGGCGGCTTCATGA CGAAATGGAGACGGAACTGAA ACCCGGACATCACCCAAAG ACGGATTTCTGCCTCTCTACACA GAAACTACCTTGTGTGCTGTCG CCCAAAATCTGTAGCCATATGC TGCTTGTCTCCCCAGGGTAT ... (line13) and RJF First, a standard curve with a plasmid containing an env gene PCR product was made and used as an external standard for qPCR analysis (Fig 4A) The initial result revealed that...
... Enhancing Performance of Solar air heater Proceedings of XVII National and VI ISHME/ASME Heat and Mass Transfer Conference, IGCAR, Kalpakkam India 2004; Jan 05-07 [2] Han J C “Heat transfer and ... rib on heat transfer ina square duct and reported that a gap in the inclined rib accelerates the flowand enhances the local turbulence which will result in an increase in the heat transfer They ... secondary flow along the rib joins the main flow to accelerate it which energizes the retarded boundary layer flow along the surface leading to an increase in the heat transfer through the gap width area...
... increase in fetal ascites, and subcutaneous edema The reversed end-diastolic flowin the MCA persisted, and an increase of PI UA was detected Alterations of ductus venosus waveform appeared, and an inversion ... or joint pain before and during pregnancy She did not refer to any vaginal bleeding Laboratory tests for Toxoplasma and rubeola showed negative immunoglobulin M (IgM) An ultrasound examination ... equipment and either a trans-vaginal or trans-abdominal approach No uterine contractions were observed during the examination Despite all of these efforts, the waveform patterns persisted for the duration...
... is a combination of prices at all leads and lags In application, the Gonzalo-Granger common factor is a linear combination of contemporaneous prices (Stock and Watson, 1988 and Gonzalo and Granger, ... the maximum and minimum fraction of total variance in pt to each market, allowing us to bound the information share from above and below The range spanned by the maximum and minimum of these factorizations ... probability of informational events, I include dollar trading volume and market capitalization as control variables 32 The mode of trading is normal in that it involves interacting with a market...
... Comparison inflow axial velocity profile of sinusoidal fluctuated flow with sinusoidal flowand steady flow profile 101 Figure 4.6 The instantaneous streamline for sinusoidal fluctuated flow at ... streamline behaviors Three types of pulsatile flow, namely the physiological pulsatile flow, equivalent physiological flowand sinusoidal pulsatileflow have been numerically simulated and comparatively ... The comparison of the numerical solutions to three types of pulsatile flows, including a physiological flow, an equivalent pulsatileflowanda simple pulsatile flow, are made The comparison of...
... Long An, Tiền Giang, An -18- Giang, Kiên Giang, Cà Mau, Sóc Trăng, Bạc Liêu, Đồng Tháp, Bến Tre, Hậu Giang, Vónh Long, Trà Vinh thành phố Cần Thơ Vò trí đ a lí Nam Bộ: ph a bắc tây - bắc giáp Cam-pu-chia, ... ngữ Nam Bộ Như vậy, không gian đ a lí tiếng miền Nam, phương ngữ miền Nam hay phương ngữ Nam tác giả xác đònh rộng Không gian đ a lí phương ngữ Nam Bộ xác đònh hẹp Ranh giới PNNB trùng với ranh ... (từ thû ấy/ đến nay), thû (từ thû ấy/ đến giờ) V a rút gọn v a đảo trật tự câu nghi vấn tính chất, đặc điểm: bao cao (cao bao nhiêu), bao dai (dài bao nhiêu), bao lớn (lớn bao nhiêu)… Rút gọn,...
... pVC51/pVC51N for AACEVAPD5 and pVC74/pVC74N for AACEVAPD6 ) [7,8] were subjected to PCR with primer sets of AP2 and adaptor for AACEVAPD1, AP2 and adaptor for AACEVAPD2, AP2 both at 50 and 30 ends for AACEVAPD3–6, ... 49 50 32 AACEVAPD1 AACEVAPD3 AACEVAPD2 AACEVAPD5 AACEVAPD4 AACEVAPD6 Vma3p Vma11p Vma16p 100 97 80 80 80 80 50 50 32 100 94 93 93 54 51 28 AACEVAPD5 AACEVAPD2 AACEVAPD3 AACEVAPD1 Table Alignments ... in AACEVAPD 2–6 represent identical amino-acid residues to AACEVAPD1 Asterisks are identical amino acids when compared to Vma3p and Vma11p, and colons are gaps Underlined sequences in Vma3p and...
... reliability of the data gathered, standardizing procedures and instruments, training of field-work and labo- ratory teams, and adjusting for several confounding variables Internal validity was assured ... (puntuación en el Cuestionario General de Salud, autovaloración del estado de salud y de la agudeza visual, grado de dificultad para caminar 300 metros, incapacidad para realizar las actividades ... appointment because of existing lines, andin obtaining medicines because of financial problems or any other problem (Table 4) ple, in China and India, higher income levels, particularly in urban...
... potential groundwater and surface water contamination by these contaminants Arsenic can exist in inorganic form, organic form, and gaseous state The oxidation states of As in the natural systems are ... +3, and +5 The main inorganic forms of As in contaminated soils and sediments are +5 and +3 (Harper and Haswell, 1988) but sometimes the oxidation states of )3 and are expected to be found in highly ... metals and occurs in about 50 minerals (Kabata-Pendias and Pendias, 2001) It is present in four different oxidation states in aqueous and subsurface systems, namely )2, 0, +4, and +6 The fate and...
... and they saw the name of this woman from Korea How would they understand the name? Ha Ha Na Three words? Ha Ha Na Miss Ha, first name Hana? Ha Ha Na Miss Na, first name Haha? Na Ha Ha Miss Haha, ... studying mechanical engineering 1.5 Formal email style Always organize your formal emails into logical paragraphs Do not write emails line by line Most formal emails contain a three or four paragraph ... at how the information is linked together in this paragraph example EXAMPLE A few years ago I had an unusual lunchtime at Hanyang I was walking on campus, when I saw Chanho Park He was visiting...
... variables measuring household material standards and generated by combining the following five items : having a shower and/ or a bath, having hot running water, having central or dispersed heating, ... two indicators: educational attainment and material deprivation Educational attainment was generated by collapsing some categories of the original variable because of the few individuals in some ... Silvia Rueda and Luc a Artazcoz Ferraro, K and Famer, M 1996 Double jeopardy Aging as leveler, or persistant health inequality ? A longitudinal analysis of white and black Americans Journal of...
... (±9) For each patients, or independent cell expansions were conducted in parallel in bags andin plates and analysed at day 20 Values are the means obtained from these independent cell amplifications ... produced using a standard multi-well plate method andin the specifically developed bags, we report here that bags can advantageously replace plates First, bags have the advantage of being a safe, ... irradiated LAZ cells) are plated in sixty 96-well plates for stimulation Ten days later, TIL are pooled and expanded in culture bags before being administered to patients (see “Materials and Methods”...
... of an unfavorable visual axis remains Owing to the difficult ergonomic situation notebooks might easily become a hindrance for productivity anda potential problem for the well being and health ... was adjusted according to a test routine described in Table and inclination of the cervical spine was measured A notebook with 15 inch screen was used Digital photo overlay techniques were applied ... to changes in the intradiscal pressure (PID) It has been suggested that an increased PID may worsen the alimentary status of the intravertebral disc that might contribute to a faster advancing...
... (±9) For each patients, or independent cell expansions were conducted in parallel in bags andin plates and analysed at day 20 Values are the means obtained from these independent cell amplifications ... produced using a standard multi-well plate method andin the specifically developed bags, we report here that bags can advantageously replace plates First, bags have the advantage of being a safe, ... irradiated LAZ cells) are plated in sixty 96-well plates for stimulation Ten days later, TIL are pooled and expanded in culture bags before being administered to patients (see “Materials and Methods”...
... (indinavir, saquinavir, lopinavir, atazanavir, or fosamprenavir) Statistical Analysis The first analysis evaluated participant characteristics associated with initiation of HAART Baseline variables ... randomized, doubleblind trial comparing combinations of nevirapine, didanosine, and zidovudine for HIV-infected patients: the INCAS Trial Italy, The Netherlands, Canada and Australia Study JAMA 1998, 279:930-937 ... associated with HAART initiation AIDS-defining illness and viral load were also associated with time to initiation of and late access to HAART As expected, those who started HAART in this study had...
... Sturm-Liouville Operators and Applications, vol 22 of Operator Theory: Advances and Applications, Birkh¨ user, Basel, Switzerland, 1986 a M A Naimark, Linear Differential Operators Part 1, Frederick Ungar, New ... York, NY, USA, 1970 B M Levitan and I S Sargsjan, Introduction to Spectral Theory: Selfadjoint Ordinary Differential Operators, American Mathematical Society, Providence, RI, USA, 1975 V A Marchenko, ... strongly regular boundary value problems,” European Journal of Pure and Applied Mathematics, vol 1, no 2, pp 51–60, 2008 K R Mamedov and H Menken, Asymptotic formulas for eigenvalues and eigenfunctions...
... statistically analyse interannual and seasonal variation of litterfall ina cork oak forest of the Montseny massif (Catalonia, north-eastern Iberian Peninsula) and its relationship with meteorological ... variables oak forests and Mediterranean oaks from relatively productive areas (Tab IV) Usually these areas are far from the coast and with high rainfall Ina previous study for the same species in ... variable and less seasonal than temperature but rainfall generally peaked in December–January and then in April–May Figure shows that the degree of overall variation (coefficient of variation) and seasonal...
... Chanteau S: Extrapulmonary and pulmonary tuberculosis in Antananarivo (Madagascar): high clustering rate in female patients J Clin Microbiol 2002, 40:3964-3969 Harries AD, Hargreaves NJ, Kwanjana ... Sifakis S, Stefanaki P, Kalogeraki A, Manidaki A, Koumantakis E: Genital tuberculosis can present as disseminated ovarian carcinoma with ascites and raised Ca125: a case report Gynecol Obstet Invest ... treated the patient for the breast cancer, revised the manuscript and gave final approval of the submitted version All authors have read and approved the final manuscript http://www.ann-clinmicrob.com/content/5/1/20...