ptsd in child and adult populations a review of the cognitive behavioral treatment outcome literature

Tài liệu PSYCHOSYNTHESIS: A Psychology of the Spirit pdf

Ngày tải lên : 15/02/2014, 15:20

... Thoreau; Nietzsche, Teilhard de Chardin, and Evelyn Underhill; Patanjali, Radhakrishnan, and Vivekananda; Ghandi, Schweitzer, Buber, and Martin Luther King; and the Buddha and Christ Further, Assagioli ... understand both analysis and syngrowth thesis, both wounding and healing, —Roberto Assagioli both personal and transpersonal growth, and both abyss and peak experiencing Again, and above all, this ... attitude that is matter -of- fact, materialistic, and perhaps jaded or cynical Unaware, we are cut off from the compassionate touch of the infinite and the eternal, and we come to assume that the...

235
958
2

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Ngày tải lên : 07/03/2014, 05:20

... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... for the remainder of the protein is: large AAA subdomain, pink; small AAA subdomain, beige; b domain, orange; non-mutated region of C-terminal a helix, cyan (B) Close-up of part of the C-terminal ... for the RDF sequence in modulating the function of the SRH The C-terminal region of human VPS4B contains the b domain (b strands and 8), the ﬁnal helix of the AAA domain (a helix 10) and the...

23
490
0

Báo cáo khoa học: Expression of the Drosophila melanogaster ATP synthase a subunit gene is regulated by a transcriptional element containing GAF and Adf-1 binding sites pptx

Ngày tải lên : 07/03/2014, 16:20

... promoter activity is boxed, and the GAGA and Adf-1 elements in the DNA are underlined The translation start codon and the main transcription start point are larger and in bold (B) Mutations either in ... footprinting of the 5¢ upstream region of the a- F1-ATPase gene and found that the combination of GAF and Adf-1 binding sites is present both in other Drosophila species (D yakuba and D pseudoobscura) and ... 5¢-CCGTCGACATTAATTTGAGAAATTATAT TGCGTCGCccgccggcCgcCacgGAGGGTGAC-3¢ (again the SalI recognition site is in bold, the location of the Adf-1 element is underlined, and nucleotides in lowercase have...

11
532
0

Báo cáo khoa học: R120G aB-crystallin promotes the unfolding of reduced a-lactalbumin and is inherently unstable ppt

Ngày tải lên : 16/03/2014, 18:20

... completed, the solution of R120G aB-crystallin and a- lactalbumin contained a heavy precipitate, whereas the mixture of wild-type aB-crystallin and a- lactalbumin was clear The sample of reduced a- lactalbumin, ... state of a- lactalbumin a- lactalbumin in the absence of aB-crystallin arises from aggregation of the molten globule state of this protein In the presence of aB-crystallin, the resonance decay ... mutant of aB-crystallin post-translational changes occur to the crystallin proteins leading to localized unfolding and the potential for aggregation and precipitation, characteristic of cataract...

14
366
0

A POSITION PAPER FROM THE CENTER FOR INQUIRY OFFICE OF PUBLIC POLICY doc

Ngày tải lên : 22/03/2014, 15:21

... Social Security Act, abstinence-only education was placed under the jurisdiction of the Administration for Children and Families in the Department of Health and Human Services The Family and ... Pediatrics, The American Foundation for AIDS Research, The American Medical Association, The American Psychological Association, The American Public Health Association, The Institute of Medicine, The ... knowledge about sexuality and relationships In place of medically accurate facts, teaching is based on unsupported assumptions and moral platitudes that not address the physical, social, and emotional...

23
364
0

báo cáo hóa học:" A MIF haplotype is associated with the outcome of patients with severe sepsis: a case control study" pdf

Ngày tải lên : 18/06/2014, 15:20

... when analyzed separately as well as analyzed as a haplotype Especially in the sub group of patients ≤60 years old and in patients with non-abdominal and non-pulmonary sepsis focus the association ... software (ABI, Darmstadt, Germany) The coincidence of the -173 C allele and the -794 CATT7 microsatellite was described as an inferred haplotype Statistical analysis of genotype distribution and ... 0.052 Data are presented as mean and range of values death due to severe sepsis compared to patients without allele CATT7 The concomitance of the -173 allele C and the -794 allele CATT7 as a haplotype...

8
554
0

báo cáo sinh học:" Is satisfaction a direct predictor of nursing turnover? Modelling the relationship between satisfaction, expressed intention and behaviour in a longitudinal cohort study" pdf

Ngày tải lên : 18/06/2014, 17:20

... were often encouraged to gain valuable management experience and/ or receive further training in a specialty (e.g accident and emergency) An increased managerial role was expected of those appointed ... satisfaction data at and 18 months using principal component analysis with varimax rotation and Kaiser normalization to ascertain whether the eight factors (Care, Staffing, Development, Relationships, ... conception of the study, the design, data collection and interpretation PG provided intellectual and theoretical input for the paper and interpretation of the findings All authors were involved in revising...

12
530
0

Báo cáo toán học: "The crossing number of a projective graph is quadratic in the face–width" doc

Ngày tải lên : 07/08/2014, 15:23

... crossings in D is within a constant factor ∆2 /(8cg ) of crg (G) Remark 4.2 In the planar case of Theorem 1.2, the described approximation algorithm yields a drawing of G within a factor 4.5∆2 of ... suitable preprocessing and then algorithm of Klein [9] (for planar distances) • Let F be the set of edges of G intersected by the (dual) edges of C ∗ Then G − F is actually a plane embedding, and ... Section Finding a large diamond projective grid Randby [11] gave, for each integer r > 0, a full characterization of those projective graphs that are minor–minimal with respect to having face–width...

8
336
0

A position paper of the EPS Energy for the Future phần 1 ppt

Ngày tải lên : 08/08/2014, 15:21

... out the analysis Climate change Since the beginning of industrialisation the world has experienced a rise in average temperature which is almost certainly due to the man-made amplification of the ... includes the handling and storage of spent fuel and, in the case of coal or oil fired plants, the retention of sulphur dioxide (SO2), unburnt carbon, and in an ideal case the storage of CO2 [3] to avoid ... Latin American countries, and the just aspirations of developing countries for reasonable standards of living all point inescapably to the need for sustainable energy sources The authors of this...

10
575
0

A position paper of the EPS Energy for the Future phần 2 ppt

Ngày tải lên : 08/08/2014, 15:21

... Safety of Spent Fuel Management and on the Safety of Radioactive Waste Management” of the IAEA [33] However, the handling of spent fuel in the long-run is a major concern In the short-run, the handling ... Asia and Middle East is rather different: there are 90 reactors in operation and a significant expansion is foreseen, especially in China, India, Japan, and the Republic of Korea [19] Nuclear power ... Extraction of uranium and plutonium from spent nuclear fuel is done routinely at La Hague (France), Sellafield (UK), Rokkasho (Japan), and Mayak (Russia) MA are not extracted and are the main...

10
434
0

A position paper of the EPS Energy for the Future phần 3 potx

Ngày tải lên : 08/08/2014, 15:21

... is too early to finally judge the relative merits of ADS and GenIV reactors as energy producing and waste incinerating/transmuting systems, but the overall favourable properties of both are obvious ... decays relatively quickly to the hands-on level within a hundred years Thereafter, the material can safely be handled on a workbench Experience in handling radioactive tritium justifies the assertion ... stimulating and funding RD&D including the nuclear energy option The European Commission has already taken on board this fundamental concept [59] • In order to obtain public acceptance and support...

10
611
0

Báo cáo y học: "Is a purpose of REM sleep atonia to help regenerate intervertebral disc volumetric loss" pdf

Ngày tải lên : 10/08/2014, 09:20

... showing their deformation with daily variations Therefore, there are two combined forces working against the task of maintaining hydraulic vertebral spacing: 1) stabilizing musculature and 2) gravity ... hypothesis That is, aquatic mammals are not under the same gravitational demands as are land mammals and not require the same buttressing spinal mechanisms for stability They may not require atonia to ... Journal of Circadian Rhythms 2009, 7:1 stand clearly the gravitational influences on all adjacently associated mammalian structural tissues related to these muscles across day and night The spine...

5
226
0

Báo cáo khoa học: "Pro/con debate: In patients who are potential candidates for organ donation after cardiac death, starting medications and/or interventions for the sole purpose of making the organs more viable is an acceptable practice" doc

Ngày tải lên : 13/08/2014, 03:20

... than a theoretical risk of precipitating or exacerbating intracranial haemorrhage and hastening death Phentolamine, a potent vasodilator, may precariously decrease blood pressure and hasten haemodynamic ... American DCD centres consider heparin administration at the time of withdrawal of lifesustaining treatment as the current standard of care [3,7] The acceptability of these practices should be evaluated ... equal proof of absence of harm; the incidence of harm from heparin is credible and has not been systematically examined A standard of practice to use heparin without good clinical evidence of...

4
301
0

a tax advantage contrary to the purpose of vat provisions

Ngày tải lên : 18/08/2014, 04:26

... Factoring, para 34 Compare Sixth Directive art 19(2) and C-98/07 Nordania Finans and BG Factoring, para 34 C-98/07 Nordania Finans and BG Factoring, para 22 C-98/07 Nordania Finans and BG Factoring, ... Royal Bank of Scotland, para 24 and para 26 Compare Sixth Directive art 17(5) third subparagraph (a) to (d) and C-488/07 Royal Bank of Scotland, para 24 and para 26 20 accordance with the latter ... combat possible tax evasion, avoidance and abuse, the need for which was recalled in paragraph 57, cannot be attained in the absence of relevant data Second, as the Advocate General stated in point...

81
287
0

a tax advantage contrary to the purpose of vat provisions

Ngày tải lên : 18/08/2014, 04:28

... Nordania Finans and BG Factoring, para 22-23 103 C-98/07 Nordania Finans and BG Factoring, para 34 104 Compare Sixth Directive art 19(2) and C-98/07 Nordania Finans and BG Factoring, para 22-23 ... Directive art 19(2) and C-98/07 Nordania Finans and BG Factoring, para 34 107 C-98/07 Nordania Finans and BG Factoring, para 22 108 C-98/07 Nordania Finans and BG Factoring, para 23 109 C-98/07 Nordania ... three examples and therefore the sale price of the taxed trader could be the lowest among the latter four examples The taxed trader was to make a profit and the profit margin was included in the...

81
311
0

Đề tài:what qualities and skill are needs for the manage people in a company? what is the importance of good human resources?

Ngày tải lên : 26/12/2014, 08:36

... learn and develop further 5)wise in the handling of document • A good manager must know how in the processing data Maybe managers are afraid of cumbersome paperwork but the manager also very intoxicated ... flexibility and social knowledge and experience of managers The objective of this skill is to enhance mutual understanding and respect on the basis of identification and recognition of the values and ... create an environment where new ideas can flow and flourish, follow some of these basic leadership and management practices 7)Information processing and thinking capacity • The power of your brain...

16
1.4K
1

a study on the main features of short jokes and implications for teaching speaking to students of grade 12 at ngoc tao upper secondary school

Ngày tải lên : 25/12/2015, 17:19

... device that creates linguistic awareness in the classroom Understanding and creating humour in a foreign language means that a language learner is consolidating knowledge and making progress The different ... geographical aspect: direction Puns playing on syntactical ambiguity Needless to say, grammar plays a very significant part in learning a language, and learning English speaking in particular as ... because it can be interpreted as meaning either that the peasants are fighting against authority, or that they are disgusting Puns surprise and entertain, expressing multiple meanings with a single...

57
672
0

Báo cáo y học: " Experimental ablation of the pancreas with high intensity focused ultrasound (HIFU) in a porcine model"

Ngày tải lên : 25/10/2012, 11:18

... into ear veins and ketamine was infused (50 mg/h) for anesthesia Diazepam was administered as needed The HIFU ablation procedure complies with the guidance of the National Standard of China and ... control, the imaging probe was placed either against the skin or at a distance from the skin in water for pre -treatment imaging The integrated transducer was mounted in a degassed water reservoir ... structures The gas-containing organs such as the gastrointestinal (GI) tracts are poor transmitters of US beam which affects HIFU targeting and ablation [13] In our pilot study, damage to the adjacent...

7
481
0

A STUDY OF THE RELATIONSHIP BETWEEN CEO COMPENSATION AND FIRM PERFORMANCE IN THE US AIRLINE INDUSTRY 2002 2006

Ngày tải lên : 11/09/2013, 11:44

... media and academia, and has experienced pressure in the legislature and economic arenas The literature suggests there are many and varied reasons for the interest in executive compensation in ... CEO age and tenure and CEO shareholdings were used as measures of CEO compensation while ROE was adapted as a measure of firm performance The results of the analysis of variance (ANOVA) indicated ... to the forefront of the media as well as academia Enron, Tyco and WorldCom are just a few of the more infamous cases involving corporate scandal that has brought about an evolution of research...

132
640
0

Computer illiteracy as one of the main problem of business student

Ngày tải lên : 26/10/2013, 17:15

... for them, instead of learning how to it themselves The third cause is lack of access to computer The fourth cause is dissatisfactory school base The fifth cause is insufficient allocation of application ... there are special classes in our university which often aren’t used by students And there are students who have skills in this sphere And they may agree to work as a consultation in these classes, ... first alternative of solving the problem, what can we suggest? We have another alternative, which is called “Simplification of access to computer classes.” We mean the organization of computer classes...

4
351
0