ptp4a3 a signal molecule deregulated in uveal melanoma metastasis
Báo cáo Y học: Defective translocation of a signal sequence mutant in a prlA4 suppressor strain of Escherichia coli doc
... of the signal sequence Tetracycline-resistant prlA+ and prlA4 Table Bacterial strains and plasmids used in this study Camr and Ampr indicate resistance to chloramphenicol and ampicillin, respectively ... Dynamics) after scanning of the autoradiogram In vitro transcription, translation, targeting and cross-linking analysis To generate truncated mRNA, plasmids encoding truncated nascent chains of ... facilitates the insertion of inner-membrane proteins in addition to catalyzing protein translocation [51,52] Membrane protein insertion and protein translocation are two distinct processes that...
- 9
- 493
- 0
Báo cáo y học: "Dantrolene and heatstroke: a good molecule applied in an unsuitable situation" ppsx
... context of CHS, a disease frequently associated with hepatic failure and/or disseminated intravascular coagulation [6] Second, there are some experimental animal studies reporting negative inotropic ... therapeutic care may benefit from advances in sepsis management, in that both syndromes share some pathophysiological similarities: cytokine and acute-phase protein production, coagulation disorders and, ... patient into the hands of an expert ‘cooling team’ as quickly as possible In order to initiate patient cooling earlier, prehospital emergency care (Service d’Aide Médicale d’Urgence; SAMU) and rescue...
- 2
- 212
- 0
Tài liệu Báo cáo khoa học: Experimental proof for a signal peptidase I like activity in Mycoplasma pneumoniae, but absence of a gene encoding a conserved bacterial type I SPase pdf
... reaction the sulfonation reagent, is present at its N-terminus instead of a free amino group [32] Therefore, the asparagine in position 26 was labeled within the intact protein at its a- amino ... N-terminal part of the peptide, it is evident that the N-terminal amino acid is asparagine (position 26), but increased in mass by 136 Da Because this modification is only possible at the free a amino ... basic amino acids (arginine and histidine) and a blocked amino terminus should not acquire more than two positive charges in positive ion mode On the other hand, the maximal charge state of a...
- 9
- 559
- 1
Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx
... BMP/activin pathway in Crassostrea gigas A Herpin et al A Crassostrea gigas C2 domain ALK-6 E fluviatilis C2 domain 77 Crassostrea gigas C1 domain 76 88 Wit D melanogaster ActR-2b H sapiens 92 Activin ... in a basal spiralian: cell lineage analyses in the polyclad turbellarian Hoploplana inquilina Dev Biol 179, 329–338 48 Lambert JD & Nagy LM (2002) Asymmetric inheritance of centrosomally localized ... below A full length 1907 base pair cDNA clone containing an open reading frame encoding 534 amino acids was isolated from a C gigas mantle edge library The predicted protein contained a number...
- 17
- 508
- 0
Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc
... transduction using strain CE1224 as the recipient and strains IQ85 and strain MM152, respectively, as donor strains To obtain strain CE1513, strain MM88 was used as Table Bacterial strains and plasmids ... immunoprecipitated with antisera directed against P48 and TF, analyzed on SDS/ PAGE and visualized with a PhosphorImager (B) Quantification of data presented in panel (A) , after correction for translation ... generate truncated mRNA, plasmids (Table 1) encoding truncated nascent chains were linearized and transcribed as described previously [13] The resulting mRNAs were translated in vitro in a lysate...
- 8
- 546
- 0
Báo cáo Y học: A functional role of the membrane-proximal extracellular domains of the signal transducer gp130 in heterodimerization with the leukemia inhibitory factor receptor pot
... C46 6A( sense) 5¢-GATAAA GCACCCGCTATCACAGACTGG-3¢; C46 6A( antisense) 5¢-CCAGTCTGTGATAGCGGGTGCTTTATCTG-3¢; C49 1A( sense) 5¢-GCAGAGAGCAAAGCCTATTTGAT AACAG-3¢ and C491(antisense) 5¢-TGTTATCAAATAG GCTTTGCTCTCTG-3¢ ... that the high affinity binding of the ligand is abrogated in this chimera, indicating that the reason for the missing signal transduction is not an incorrect spacing between the ligand binding ... demands are posed to the individual FNIII domains for signal transduction Because domain of gp130 can be replaced by a similar domain of a different receptor without abrogation of signal transduction,...
- 11
- 583
- 0
A Single-Molecule Perspective on the Role of Solvent Hydrogen Bonds in Protein Folding and Chemical Reactions pptx
... unfolding the I27 protein in D2O The pulling coordinate for the separating b-strands is defined as the distance between the first amino acid of strand A (Y9) and the last amino acid of strand ... result of a delicate balance between intramolecular and hydration interactions, D2O may alter the dynamics of protein function in subtle and non-intuitive ways.[32–35] Interestingly, in contrast to ... pulling coordinate for the A and G b-strands as the distance between the first amino acid of strand A (Y9) and the last amino acid of strand G (K87) This distance, x(Y9)ÀxACHTUNGRE(K87), increases...
- 12
- 553
- 0
báo cáo hóa học:" Identification of a public CDR3 motif and a biased utilization of T-cell receptor V beta and J beta chains in HLA-A2/Melan-A-specific T-cell clonotypes of melanoma patients" potx
... CAGCCCCAGCA T .TATGGCTACACC .CAGCCCCAGCA T .CAGCCCCAGCA T .CAGCCCCAGXX X .CAGCCCCAGXX X .CAGCCCCAGCA T TTCACCCCT CCAC TCAGCCCCAGXX X TCAGCCCCAGXX X TCAGCCCCAGCA T .CAGCCCCAGCA T .CAGCCCCAGCA ... CAGGGGGC TCGG 42 GCCAGCAGT G T .ACAGGGG CTCGG D/b GCCAGTAGTAT GACAGGG CTAGGG AGTGC GCCCGAT .ACAGGG CTTGGC GCCAGCAG ATACCA GGGAC TAGGA 39 GCCTGGAGTGT C C CAGGG CTAGG NA XXXXXXAGT CAT CAGGG ... cNA: ID not available; dm: modified Melan -A A27L; eClonotype was obtained from one T- clone was obtained before and one after vaccination; fX: amino acid not available; gn: natural Melan -A In...
- 14
- 532
- 1
Báo cáo hóa học: "High activity of sequential low dose chemo-modulating Temozolomide in combination with Fotemustine in metastatic melanoma. A feasibility study" pptx
... staging and classification J Clin Oncol 2009, 27(36):6199-206 Guida M, Latorre A, Mastria A, et al: Subcutaneous recombinant interleukin-2 plus chemotherapy with cisplatin and dacarbazine in metastatic ... Sequential interferon-alpha2b, interleukin-2 and fotemustine for patients with metastatic melanoma Melanoma Res 2000, 10(5):475-82 Avril MF, Armadal S, Grab JJ, et al: Fotemustine compared with Dacarbazine ... fotemustine in medulloblastoma and malignant glioma xenografts in relation to O6alkylguanine-DNA alkyltransferase and alkylpurine-DNA N-glycosylase activity Clin Cancer Res 1998, 4(2):463-8 Belanich...
- 8
- 459
- 0
Báo cáo sinh học: " Inhibition of phosphorylated c-Met in rhabdomyosarcoma cell lines by a small molecule inhibitor SU11274" pdf
... independently analyzed by two investigators The staining score was calculated from the staining intensity and percentage of positive staining cells The staining intensity was scored as (very weak), (weak), ... Seiwert TY, Jagadeeswaran R, Faoro L, Janamanchi V, Nallasura V, El Dinali M, Yala S, Kanteti R, Cohen EE, Lingen MW, et al: The MET receptor tyrosine kinase is a potential novel therapeutic target ... financial support, edit and finalize the manuscript All authors have read and approved the final manuscript 15 16 17 18 19 Competing interests The authors declare that they have no competing interests...
- 10
- 402
- 0
báo cáo hóa học:" Inhibition of phosphorylated c-Met in rhabdomyosarcoma cell lines by a small molecule inhibitor SU11274" pdf
... independently analyzed by two investigators The staining score was calculated from the staining intensity and percentage of positive staining cells The staining intensity was scored as (very weak), (weak), ... Seiwert TY, Jagadeeswaran R, Faoro L, Janamanchi V, Nallasura V, El Dinali M, Yala S, Kanteti R, Cohen EE, Lingen MW, et al: The MET receptor tyrosine kinase is a potential novel therapeutic target ... financial support, edit and finalize the manuscript All authors have read and approved the final manuscript 15 16 17 18 19 Competing interests The authors declare that they have no competing interests...
- 10
- 373
- 0
Báo cáo sinh học: "Madm (Mlf1 adapter molecule) cooperates with Bunched A to promote growth in Drosophila" pot
... 2D2, a deletion causes a frameshift after amino acid 385, resulting in a premature translational stop after an additional 34 amino acids Alleles 3Y2, 4S3, and 7L2 lead to a pinhead phenotype of intermediate ... that the interaction with BunA altered the subcellular locali za ion of HA-Madm (Figure 2c) A statistical analysis t (Materials and methods) revealed that HA-Madm was only localized in punctae ... - * amino acids 1-637 amino acids 1-113 amino acids 1-397 amino acids 90-637 amino acids 398-637 amino acids 398-566 amino acids 458-566 amino acids 458-530 R525H dMadm full-length N-terminus...
- 15
- 286
- 0
Báo cáo y học: "Effect of a small molecule inhibitor of nuclear factor-κB nuclear translocation in a murine model of arthritis and cultured human synovial cells" pps
... (5'-TGCACGATGCACCTGTACGA, 3'-AGGCCCAAGGCCACAGGTAT), IL-6 (5'-GTTCCTGCAGAAAAAGGCAAAG, 3'-CTGAGGTGCCCATGCTACATTT), matrix metalloproteinase (MMP)-3 (5'ATGGAGCTGCAAGGGGTGAG, 3'-CCCGTCACCTCCAATCCAAG), and ... in clinical trials [26] We previously showed that chemokines CCL2 and CCL5 play a role not only in inflammatory cell migration but also in activation of RA FLS in an autocrine or paracrine manner ... treated with DNase I (Takara, Ohtsu, Japan), and RT-PCR was carried out using OneStep RT-PCR Kit (Qiagen) and the following primers: β-actin (5'-GTCCTCTCCCAAGTCCACACA, 3'-CTGGTCTCAAGTCAGTGTACAGGTAA),...
- 12
- 459
- 0
Báo cáo y học: "LMP-420, a small-molecule inhibitor of TNF-alpha, reduces replication of HIV-1 and Mycobacterium tuberculosis in human cell" pps
... Grau GE: Inhibition of endothelial activation: a new way to treat cerebral malaria? PLoS Med 2005, 2:e245 Vicenzi E, Alfano M, Ghezzi S, Gatti A, Veglia F, Lazzarin A, Sozzani S, Mantovani A, ... LMP-420 inhibits replication of M Tb in human alveolar macFigure rophages (AM) LMP-420 inhibits replication of M Tb in human alveolar macrophages (AM) AM were collected by bronchial-alveolar lavage ... methotrexate or azathioprine An advantage of a small -molecule inhibitor of TNF transcription and release (such as LMP-420) over biologicals such as infliximab or etanercept is that such a molecule...
- 9
- 404
- 0
Extracellular signal-regulated kinase 1/2 plays a pro-life role in experimental brain stem death via MAPK signal-interacting kinase at rostral ventrolateral medulla pps
... At the same time, as the origin of a life-and-death signal [5] that reflects failure of the central cardiovascular regulatory machinery during brain stem death [6-8] and a brain stem site via ... Pharmacological blockade was again used to ascertain that these temporally correlated biochemical changes are causally linked to MEK1/2 or ERK1/2 activation in RVLM during experimental brain ... Bonventre JV, Alessandrini A: Intravenous administration of MEK inhibitor U0126 affords brain protection against forebrain ischemia and focal cerebral ischemia Proc Natl Acad Sci USA 2001, 98:11569-11574...
- 9
- 201
- 0
Báo cáo khoa hoc:" CP-31398, a putative p53-stabilizing molecule tested in mammalian cells and in yeast for its effects on p53 transcriptional activity" potx
... (p21_sense_SalI 5'-TCG AGC CGT CAG GAA CAT GTC CCA ACA TGT TGA GCT G-3' and p21_anti_XbaI 5'-CTA GCA GCT CAA CAT GTT GGG ACA TGT TCC TGA CGG C-3') into the XbaI and SalI sites of the vector backbone ... β-galactosidase assay to measure activation of the lacZ reporter gene Wild type p53 and the indicated point mutant variants were transformed into the p53 responsive reporter strain and β-galactosidase ... should be suitable to assess DNA-binding and transcriptional activation activity regardless of posttranslational modifications and other influences that are inevitable when p53 is studied in the context...
- 9
- 485
- 0
báo cáo khoa học: " STIL, a peculiar molecule from styles, specifically dephosphorylates the pollen receptor kinase LePRK2 and stimulates pollen tube growth in vitro" ppt
... in pollen tube reorientation by chemocyanin or its Arabidopsis homolog, plantacyanin [61,62] Arabinogalactan proteins (AGPs) have also been involved in modulating pollen tube growth in Solanaceous ... correlated with absorbance at 280 nm and amino acid determination (Table 3) showed that several amino acids are present in the STIL molecule Amino acid determination relies on acid hydrolysis and ... (0.36 Abs280 units) μl were assayed in the LePRK2 dephosphorylation assay Amino acid determination Amino acid determination is based on acid hydrolysis of the sample, derivatization and separation...
- 11
- 379
- 0
Báo cáo y học: " A novel small molecule target in human airway smooth muscle for potential treatment of obstructive lung diseases: a staged highthroughput biophysical screening" pps
... (Grand Island, NY) The synthetic arginine-glycine-aspartic acid (RGD) containing peptide was purchased from American Peptide Company (Sunnyvale, CA) Primary antibodies against HSP20, cofilin, ... diluted appropriately in serum-free media on the day of use Statement on animal welfare Fischer 344 rat strains (male, 7-9 wk-old) were purchased from Harlan Sprague-Dawley, Inc (Indianapolis, IN) and ... previously by us and others [14,24], bovine tracheal strips and rat tracheal rings (i.e transverse rings, 1.0 mm in width) were prepared and mounted in organ bath containing a bicarbonate buffer Tissue...
- 9
- 496
- 0
Role of the survival proteins hsp27 and survivin in a small molecule sensitization to TRAIL mediated apoptosis 1
... inducing factor ANT: adenine nucleotide transporter AP-1: activating protein-1 APAF: apoptosis activating factor-1 Asp: aspartate ATP: adenosine triphosphate Bad: Bcl-2 antagonist of cell death ... MK2: MAPK-activated protein kinase MK5: MAPK-activated protein kinase MOMP: outer membrane permeabilization xvii mRNA: messenger RNA mTOR: mammalian target of rapamycin NADPH: nicotinamide adenine ... extracellular signals such as death ligands, that involves DISC formation and where the initiator caspase-8 plays a major role On the other hand, an intrinsic pathway, in response to signals affecting...
- 104
- 323
- 0
Role of the survival proteins hsp27 and survivin in a small molecule sensitization to TRAIL mediated apoptosis 2
... the appearance of a 17 kDa cleaved fragment of caspase-3 at 8h following treatment with LY30 and TRAIL (Figure 18D), indicating an activation of pro-caspase-3 via proteolytic cleavage The caspase-3mediated ... 15B) In addition, an alternate analysis of the data for the 4h time point indicated that LY30+TRAIL treatment, and to a lesser extent LY30 alone, was inducing an early mitochondrial aggregation ... resulted in minimal caspase activation (less than fold increase) after 6h and 12h of treatment However, LY30 treatment resulted in an increased caspase-8 and -9 activity at 18h In addition, we...
- 125
- 234
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25