pseudocode for a parallel mpi version of the mandelbrot set generation program
báo cáo hóa học: " Validation of a French language version of the Early Childhood Oral Health Impact Scale (ECOHIS)" ppt
... methodology and analytic strategies used, the performance of the French ECOHIS and the extent of the validation tests In terms of the methodological and analytical approaches, there are two limitations ... discriminant validity The results of this validation process indicated that Cronbach's alpha was 0.79 for each of the child and family impact sections and 0.82 for the whole scale, the intra-class ... estimated through generation of Cronbach's alpha for the child and family impact sections of the scale separately, plus the instrument as a whole Item-scale and child-family scale correlations...
- 7
- 429
- 0
Báo cáo hóa học: " Development and validation of a Greek language version of the Manchester Foot Pain and Disability Index" docx
... pain were asked to indicate the location of the pain on eight diagrams of the feet The participants then completed the Greek language version of the MFPDI A total score for the MFPDI was obtained ... ground and while keeping the trunk upright The position of the fibular head was marked on the clear acrylic plate, and the angle formed between the lateral malleolus and the fibular head was measured ... Thomas E, Jayson MI, Macfarlane GJ: The grading of hallux valgus The Manchester Scale J Am Podiatr Med Assoc 2001, 91:74-78 Menz HB, Munteanu SE: Radiographic validation of the Manchester scale for...
- 9
- 481
- 0
Báo cáo hóa học: " Validity and reliability of the Spanish version of the DN4 (Douleur Neuropathique 4 questions) questionnaire for differential diagnosis of pain syndromes associated to a neuropathic or somatic component" docx
... score of to each negative item The total score is calculated as the sum of all 10 items, and the cut-off value for the diagnosis of neuropathic pain is a total score of 4/10 All questions are related ... logistic and evaluation of data All authors read and approved the final manuscript Additional material Additional file Cuestionario DN4 This appendix includes the Spanish version of DN4 questionnaire ... Spain), Mar a Madariaga (Hospital de la Princesa, Madrid, Spain) and Carmen Martínez-Valero (Hospital Universitario, Virgen de las Nieves, Granada, Spain) for their collaboration in the study...
- 10
- 532
- 0
Báo cáo hóa học: " Development of a parent version of the Manchester-Minneapolis quality of life survey for use by parents and carers of UK children: MMQL-UK (PF)" potx
... questionnaires for 12–18 and 19–25 year olds No parent form is available for the original MMQL forms The anglicised MMQL-UK (CF) version of the questionnaires (based on the 12–18 year age group) was used as ... the primary researcher, was responsible for co-ordinating and managing the study on a day-to-day basis, for data collection and collation, data analysis and input into writing the manuscript WYC ... Background The measurement of health-related quality of life (HRQL) is increasingly becoming part of the overall assessment of a patient's health both in the clinical and the research setting, as it provides...
- 8
- 609
- 0
báo cáo hóa học:" Validation of a Greek version of the Oral Health Impact Profile (OHIP-14) for use among adults" pdf
... clinics of the Dental Schools of Athens and Thessaloniki ii) dental clinics of the Social Insurance Fund of Greece (IKA) in Athens and Thessaloniki and iii) a selected professional corporation These ... based on: a) the availability of an appropriate middle-age group of the population in one place, b) the possibility to perform a clinical examination along with completion of a questionnaire and ... Method and Data Analysis The OHIP-14 score was calculated using the additive method Statistical analysis was performed using the Statistical Package for Social Sciences (SPSS) v.19 To assess the...
- 30
- 235
- 0
báo cáo hóa học:" Validity and reliability of the Spanish version of the DN4 (Douleur Neuropathique 4 questions) questionnaire for differential diagnosis of pain syndromes associated to a neuropathic or somatic component" pdf
... score of to each negative item The total score is calculated as the sum of all 10 items, and the cut-off value for the diagnosis of neuropathic pain is a total score of 4/10 All questions are related ... logistic and evaluation of data All authors read and approved the final manuscript Additional material Additional file Cuestionario DN4 This appendix includes the Spanish version of DN4 questionnaire ... Spain), Mar a Madariaga (Hospital de la Princesa, Madrid, Spain) and Carmen Martínez-Valero (Hospital Universitario, Virgen de las Nieves, Granada, Spain) for their collaboration in the study...
- 10
- 489
- 0
báo cáo khoa học: " A Guide for applying a revised version of the PARIHS framework for implementation" pdf
... and a set of questions for diagnostic analysis and planning All of the separate components of the actual Guide are contained in additional files (see Additional Files 1, 2, and 4) The main narrative ... need for clear conceptual and operational definitions, measurement approaches, and additional practical information about the realities of application • QUERI frames of reference and concepts affected ... use of the terms task versus organizational purpose from the PARIHS framework’s approach to Facilitation The latter envisages the purpose of Facilitation to occur along a continuum from primarily...
- 10
- 458
- 0
Báo cáo y học: " Assessing medically unexplained symptoms: evaluation of a shortened version of the SOMS for use in primary care" doc
... data; MCS and CF drafting the manuscript; AB, MF and WR interpretation of data, critical revisions of the manuscript All authors read and approved the final manuscript Acknowledgements We thank ... longitudinal assessment of the case and all data from medical records were evaluated to form a diagnosis of Clinical Somatizers (CS), taking into account the number of validated unexplained symptoms ... period all symptoms for which a medical explanation was in doubt were further discussed with the participant's GP The history of somatoform complaints was made for each subject As a standard procedure,...
- 10
- 314
- 0
Báo cáo y học: "Evaluation of the psychometric properties of a modified version of the Social Phobia Screening Questionnaire for use in adolescents" pdf
... responsible for writing the manuscript AB planned the design of the study, collected data and conducted the analyses, took part in reading the ms and approved to the final version of the ms TF ... regarding socio-demographics The same procedure, with the same classes of students, was used three weeks later As a compensation for their participation, the students had a chance of winning a ... a movie in a lottery that was conducted in each class after all students had completed their questionnaires at the first and second assessment A case-control design was adopted for the evaluation...
- 7
- 371
- 0
Application of house’s model for translation quality assessment in assessing the english version of the vietnam’s law on investment no. 59/2005/qh11
... Tiersma, the history of English legal language can be summarized as follows: The Anglo-Saxons drove away the Celtic language of the original inhabitants of England and their laws left traces in ... and strategies of translation, as well as assessment and evaluation of translations This study aims at revealing the most basic features of Vietnamese and English legal language, and basic concepts ... literal translation or translation label plus transcription The choice of strategies for the translation of a text depends on the purpose of the translation and the componential analysis of the ST...
- 86
- 894
- 5
A TRANSLATION QUALITY ASSESSMENT OF THE VIETNAMESE VERSION OF US FINANCIAL & ACCOUNTING APPLICATION SOFTWARE
... covers the following aims: a To discover what language qualities the SL text of US F &A application software has based on the language qualities of a technical language text b To assess the translation ... most typical theoretical issues laying the foundation for the translation quality assessment of US F &A application software in the later part of the thesis With regard to technical translation, ... terms The translation of Noun phrases The translation of Verb phrases III.2.3 The Translation of Application Messeges III.3 The Evaluation of the Translation III.4 Sumary of Chapter's Findings Part...
- 72
- 577
- 2
Tài liệu Research " The Dissertation Committee for Fang Yin Certifies that this is the approved version of the following dissertation: Business Value of Information Technology in the Internet Economy " doc
... of employees as a proxy for the labor input The total labor cost can be thought of as a product of the number of employees and an average annual salary plus benefits Then the log of the average ... software and network equipments are used as the base for the IT capital measure These data are available in the 10K reports of the publicly traded companies Almost all the companies list the beginning ... growth, wasteful spending, etc.), the academic literature on the performance analysis of dot coms is sparse at best Yet an analysis of the performance of various types of dot coms can provide valuable...
- 163
- 731
- 0
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf
... 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, ... 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢ The PCR solution was prepared in the buffer supplied with the enzyme, and contained Aba, Abb and Abc at 40 nm each, and the start and stop primers Abstart ... Abstart and Ab42stop (5¢-CCTG CCGAGCTCCTATTAAGCGATCACAACGCCACCAA CCATCAG-3¢) and a sequence-verified plasmid carrying the Ab(L1–40) gene This adds Ile41 and Ala42 to the peptide sequence The PCR...
- 16
- 691
- 0
Monochorionic triamniotic triplet pregnancy with a co-triplet fetus discordant for congenital cystic adenomatoid malformation of the lung ppt
... participated in the design of the manuscript and AC participated in editing of the manuscript YC was the director of the Maternal and Fetal Medicine Unit and participated in the design and revision of ... hospitalization, the vaginal bleeding ceased and the patient was discharged to follow-up A 26 year-old woman was referred to our maternal and fetal unit for detailed ultrasonographic examination ... gestational sac at weeks and ipsilon zone at 15 weeks, and by pathological examination of the placenta after delivery Figure congenital cystic adenomatoid malformation months: cystic masses in the...
- 5
- 484
- 0
Đề tài " A quantitative version of the idempotent theorem in harmonic analysis " docx
... refinement of) Ruzsa’s analogue of Freiman’s theorem, which gives a fairly strong characterisation of subsets A ⊆ Fn satisfying a small doubling condition |A + A| K |A| An analogue of this theorem for any ... |A| , there are at least |A| m /2 such m-tuples We know that either the vectors a1 , , am are not dissociated, or else there is a further a ∈ A such that a lies in the linear span of the In either ... suppose that there are at least δ |A| 3 additive quadruples (a1 , a2 , a3 , a4 ) in A4 with a1 + a2 = a3 + a4 Then there is a regular Bourgain system S satisfying dim(S) Cδ −C ; |S| e−Cδ −C |A| and...
- 31
- 523
- 0
A Checklist for Retrospective Database Studies—Report of the ISPOR Task Force on Retrospective Databases pot
... validity are not static attributes of a database but can vary dramatically depending on the questions asked and analyses performed Quality checks are particularly important with administrative databases ... as any other pharmacy benefit characteristics that could affect the use of the drugs, Reliability and Validity: Have the Reliability and Validity of the Data Been Described, Including Any Data ... the natural history of the disease being studied and the time period for analysis? The researcher must address the pros and cons of the database in the context of what is known about the natural...
- 8
- 472
- 0
báo cáo sinh học:" A framework for evaluating the impact of the United Nations fellowship programmes" ppt
... Analysis approach and therefore adopts this specific modality, with the elaborated milestones pathway as the platform for future implementation and evaluation of Training and Fellowship Capacity ... Geneva Authors’ contributions AR was primarily responsible for the formulation of the evaluation framework and for drafting the paper MZ was primarily responsible for the literature review and AG ... can we take credit for an improved state of affairs The initial analysis of training needs provides an assessment of the level of competence before training and enables verification Rotem et al...
- 8
- 520
- 0
báo cáo hóa học: " Validity and internal consistency of a Hausa version of the Ibadan knee/hip osteoarthritis outcome measure" pdf
... interview All the patients reported clarity of the Hausa language and ease of understanding of all the items The final version of the Hausa translation of IKHOAM (see Additional file 2) The anchors (English) ... of IKHOAM The divergent validity of the Hausa version of IKHOAM was analyzed by subjecting participants' scores on the Visual Analogue Scale and the Hausa version of IKHOAM to Spearman rank Order ... correlation Internal consistency of the parts of the Hausa version of IKHOAM was calculated using the Cronbach's alpha Level of significance was set at 0.05 The SPSS 12 software program was used...
- 5
- 458
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25