psa which equipment is needed to monitor the patient and to be immediately available at the bedside
Báo cáo y học: " Harmonization of monographic standards is needed to ensure the quality of Chinese medicinal materials" docx
Ngày tải lên :
13/08/2014, 15:21
... introduced into the British Pharmacopoeia Furthermore, collaboration has been established between the British and Chinese Pharmacopoeias in order to exchange information on quality standards for ... standards of safety and quality Registered THMs are regulated by the Traditional Herbal Medicines Registration Scheme and are required to meet specific safety and quality standards and to be accompanied ... herbal medicines which facilitate assessment of registration applications and gives a reference standard to inform the manufacturers and importers of the UK regulations For the first time, a...
- 5
- 343
- 0
She is going to go on business at the end of June potx
Ngày tải lên :
02/04/2014, 21:21
... dụ: at the end of the street (cuối đường), at the end of the book (cuối sách) Mạo từ the đứng trước từ bắt đầu nguyên âm “a, e, i, o, u”, the phát âm /ði/ - Trái nghĩa với at the end” at the ... the beginning” – bắt đầu Ví dụ at the beginning of May” – vào đầu tháng Năm - Cần ý phân biệt "at the end of " "In the end" để tránh nhầm lẫn “in the end” = “finally” – cuối cùng, sau “in the ... biết thêm chi tiết từ đó) She is going to go on business at the end of June 2 Các bạn di chuột vào cụm từ để biết chức cụm câu: She is going to go on business at the end of June 3 Tại câu lại...
- 5
- 631
- 0
This is the first version of this article to be made available publicly. docx
Ngày tải lên :
09/08/2014, 20:20
... for the analysis of microarray gene expression data Computational Statistics and Data Analysis 2002, 39, 1-20 Pounds S and Morris SW: Estimating the occurrence of false positives and false negatives ... that the answer to this basic question has a bearing on the other ones In the two-component model for the distribution of the test statistic the mixing parameter p0, which represents the proportion ... method like the EM algorithm That algorithm is crucially dependent on a good start of the iteration Such a combined algorithm remains to be explored Another twist would be to take the estimate of...
- 10
- 265
- 0
Báo cáo y học: "The electronic version of this article is the complete one and can be found online at" pps
Ngày tải lên :
14/08/2014, 14:21
... regulatory characteristics we conclude that these genes are functionally related to the biotin pathway The most plausible hypothesis is that they encode a novel pathway for pimeloylCoA synthesis, ... gTGAtAtTGAaaTTCtT 394231 -122 tTGAcAtTGAaaaTCAT AraC-type regulator tTGAtttTGAgTTTCAT cTGgtttTCATTaTCAT FoxR GGDEF domain protein 3.91 4.72 tTGAAAATCATTTTCgc 395154 gdp* -60 -54 tTGAgttTCATaTTCAT ... In the case of the cooMKLXUHF operon in D vulgaris, the HcpR site is located upstream of the candidate site of the known positive regulator CooA; thus it is also predicted to be an activator...
- 27
- 356
- 0
What is the question to which ‘substitution’ is the answer
Ngày tải lên :
01/11/2013, 10:20
... of Totality and Infinity is that it is only for an already established ‘I’ that the other arises The separated I, the subject, is put in question by the other but it is only with the somewhat ... on this account, but that does not mean that the relation to being in which the ethical is situated is not crucial This is why it is not irrelevant what is said in the saying, just as it is not ... of the same: the negation of the I by the self is precisely one of the modes of identification of the I [ti 37] That is to say, Levinas in Totality and Infinity can be understood as rejecting the...
- 18
- 849
- 0
Tài liệu Which Bank Is the “Central” Bank? An Application of Markov Theory to the Canadian Large Value Transfer System doc
Ngày tải lên :
16/02/2014, 12:20
... transactions in the LVTS from October 1st 2005 to October 31st 2006 This data set consists of 272 days in which the LVTS was running The participants in the sample consist of members of the LVTS and the ... cash distribution and the stationary distribution) The second block is a random walk Metropolis-Hastings step to draw a realization 12 The precision is just the inverse of the variance 11 of the ... value in the stationary vector is predicted to hold the most liquidity throughout the day and is thus the “central” bank An attractive feature of our application of Markov chain theory is that it...
- 20
- 438
- 0
Báo cáo y học: "Trauma research in low- and middle-income countries is urgently needed to strengthen the chain of survival" pptx
Ngày tải lên :
13/08/2014, 23:20
... facilities located in major cities [4] The rate of prehospital death is highest in the countries with least resources [5] Worldwide, there is a mismatch between the distribution of doctors and injuries ... injuries [9] These patients were severely injured, and the authors found a correlation between delay in ICU admission and mortality, amongst others Iteke and co-workers have investigated the frequency ... should be promoted, and what types of equipment and supplies should be stocked in ICUs globally are all questions that need to be answered before firm recommendations about ICU care globally can be...
- 8
- 352
- 0
This questionnaire is designed to investigate teachers’ attitude towards the applicability of process approach in teaching writi
Ngày tải lên :
07/09/2013, 13:51
... Comments of the T and S on the topics and exercises in the textbook According to the result shown in the table, the majority of the subjects indicated that the topics and exercises in the textbook ... itself to the focus on the purposes of linguistic communication Up to dates, there are several ways to approach writing in the classroom It should be said at the beginning that there is not necessarily ... questions We, therefore, hardly know what really happens in the classroom Given the limitations of the study, further research is needed to gain a better understanding of the issue related to process...
- 31
- 560
- 2
Tài liệu In this lab, 2 ISDN routers are required. If ISDN routers are not available, review the lab to become familiar with the process. An Adtran Atlas550 ISDN emulator is used to simulate the switch/ISDN cloud. pdf
Ngày tải lên :
21/12/2013, 19:15
... Please refer to the chart at the end of the lab to correctly identify the interface identifiers to be used based on the equipment in the lab The configuration output used in this lab is produced ... static and default routes instead of dynamic routing, in order to reduce the cost of the dialup connection To configure a static route, the network address of the network that is going to be ... Copyright 2003, Cisco Systems, Inc c What authentication type is being used for PPP? d Which sections of the configuration list the authentication type? ...
- 8
- 419
- 0
Tài liệu Báo cáo khoa học: The PA-TM-RING protein RING finger protein 13 is an endosomal integral membrane E3 ubiquitin ligase whose RING finger domain is released to the cytoplasm by proteolysis ppt
Ngày tải lên :
18/02/2014, 08:20
... suggesting that the N-terminal portion of the protein containing the HA epitope was lost from these proteins by proteolysis To determine which of the RNF13 bands is the initial biosynthetic product, ... RNF13D1–204 3· FLAG381 localized to the cytoplasm (Fig 9C) This is in agreement with our cell fractionation data, which also indicated that it is localized to the cytosol (data not shown) cin l my C SO ... in receptor 1870 endocytosis and in the formation of multivesicular endosomes is well established [52], but few endosomal E3s have been characterized, and none has been shown to be regulated by...
- 18
- 483
- 0
Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf
Ngày tải lên :
19/02/2014, 17:20
... pepstatin A) was added to cell lysates and media (10 lgÆmL)1 for each) Unless stated otherwise, iodoacetoamide was not added to the lysates and media The lysates were incubated for 20 at 37 °C to ... protein that is degraded via the ubiquitin ⁄ proteasome pathway TNSALP (D289V), which is associated perinatal hypophosphatasia, is another example [14] These findings suggest that the biosynthesis of ... nucleotide of the cDNA clone originally isolated by Weiss et al [8] TNSALP (1559delT) is unique in that so far, this frameshift mutation has been reported only in the Japanese population [18] The patients...
- 14
- 445
- 0
The nobel prize in physiology or medicine 2010 is awarded to
Ngày tải lên :
23/02/2014, 20:45
... Secretary of the Nobel Assembly; Outi Hovatta, Obstetrics and Gynaecology; Christer Höög, Genetics; Klas Kärre, Immunology, Chairman of the Nobel Committee; Hugo Lagercrantz, Paediatrics; Urban ... làm đc điều này, ông hợp tác với bác sĩ Patrick Steptoe bệnh viện Oldham Steptoe người tiên phong lĩnh vực nội soi, ý tưởng cho mục đích R.E Patrick Steptoe bác sĩ hợp tác với R.E để phát triển ... tinh ống nghiệm giới Patrick Steptoe Giám đốc Y khoa Bourn trường Clinic ông qua đời vào năm 1988, Robert Edwards giám đốc nghiên cứu ông nghỉ hưu IVF cải thiện lan rộng to n giới Các kỹ thuật...
- 7
- 370
- 1
Báo cáo khoa học: Structure of Streptococcus agalactiae serine⁄threonine phosphatase The subdomain conformation is coupled to the binding of a third metal ion pptx
Ngày tải lên :
07/03/2014, 09:20
... One residue that appears to take part in catalysis in HsSTP is His62, which may act as a general acid and protonate the phosphate as it leaves [11], but this residue is missing from the prokaryotic ... The N- and C-termini, and the two b sheets are labeled (B) The structure has been rotated through 90 ° around the y-axis The flap subdomain is at right angles to the core structure (C) Comparison ... lead to binding of a third metal ion The implications of the M3 binding and flap subdomain conformations to the catalytic mechanism are discussed below The role of the third metal in catalysis In...
- 10
- 542
- 0
Báo cáo khoa học: A region within the C-terminal domain of Ure2p is shown to interact with the molecular chaperone Ssa1p by the use of cross-linkers and mass spectrometry doc
Ngày tải lên :
15/03/2014, 00:20
... interactions between Ure2p molecules within the fibrils, to that spanning lysines 327–339 The finding that lysine 325 from Ssa1p, which is located at the interface between the nucleotide and cli- FEBS ... are denoted T and CT, respectively The protonated monoisotopic experimental masses (MH+exp) and the calculated mass difference (p.p.m.) with the theoretical monoisotopic mass of the identified ... peptides The list of light and heavy precursor masses was further used either to analyze the MS ⁄ MS spectra acquired in the data-dependent acquisition analysis or to build an inclusion list with the...
- 12
- 510
- 0
Economic Effects of Reducing the Fiscal Restraint That Is Scheduled to Occur in 2013 docx
Ngày tải lên :
15/03/2014, 20:20
... effect on the level of GDP at the That estimate is smaller than the change in the automatic stabilizers from 2012 to 2013 that is presented in Table C-2 of The Budget and Economic Outlook: Fiscal ... 2011 The expiration of that provision will raise revenues by $95 billion Various other provisions affecting the tax code are also slated to expire by the end of this year or expired at the end ... REDUCING THE FISCAL RESTRAINT THAT IS SCHEDULED TO OCCUR IN 2013 expects—with the economy projected to contract at an annual rate of 1.3 percent in the first half of the year and expand at an annual...
- 10
- 538
- 0
Báo cáo khoa học: MPP3 is recruited to the MPP5 protein scaffold at the retinal outer limiting membrane ppt
Ngày tải lên :
16/03/2014, 13:20
... ACAAAGACCATGACGGTGATTATAAAGATCATGAC ATCGATTACAAGGATGACGATGACAAGCTCATG-3¢ (sense), and 5¢- GTACAGCTTGTCATCGTCATCCTTG TAATCGATGTCATGATCTTTATAATCACCGTCATGG TCTTTGTAGTC-3¢ (antisense), and ligated into a blunted SphI site ... vectors pBabe-CMVNeo or pBabe-CMV-Hygro A FLAG epitope tag was created at the N-terminus of human MPP3 by annealing the following primers: 5¢-GACT ACAAAGACCATGACGGTGATTATAAAGATCATGAC ATCGATTACAAGGATGACGATGACAAGCTCATG-3¢ ... OLM, and at the OPL In mouse retina, Mpp3 was detected at the SAR of the OLM, and at the OPL and IPL Here, we showed that MPP3 forms protein complexes and colocalizes with MPP5 at the SAR of the...
- 14
- 449
- 0
Báo cáo khoa học: Methods to monitor the quaternary structure of G protein-coupled receptors doc
Ngày tải lên :
16/03/2014, 22:20
... function of distance between energy donor and acceptor Relationship between the energy transfer efficiency (Y-axis) and the distance between the energy donor and acceptor (X-axis) The distance is expressed ... donor and acceptor is within the region of the FRET R0 (i.e.: the distance between the donor and acceptor leading to 50% of the maximal transfer efficiency) where the Denergy transfer ⁄ Ddistance is ... expressed as the ratio of the distance ‘r’ separating the donor and the acceptor over the distance resulting in 50% of the maximal efficacy (R0) As indicated by the Forster equation, the efficiency...
- 12
- 337
- 0
how the use of the diary form narrative is beneficial to the
Ngày tải lên :
21/03/2014, 22:04
... When, there are different people of different places, they can be identified by how they act and how they talk If, Bram Stoker did not use the diary form narrative, this would not be possible because ... one person was telling the whole story, the reader would see and hear what the person telling the story heard and wrote down So using, the diary, Bram Stoker could make the reader "see" exactly ... when the diary form of narrative is used For instance, after Lucy had written what was happening to her when her mother passed away, the story went back in time for another important matter to...
- 2
- 473
- 0
Báo cáo khoa học: A hydrophilic cation-binding protein of Arabidopsis thaliana, AtPCaP1, is localized to plasma membrane via N-myristoylation and interacts with calmodulin and the phosphatidylinositol phosphates PtdIns(3,4,5)P3 and PtdIns(3,5)P2 pptx
Ngày tải lên :
23/03/2014, 07:20
... mutant (Fig 5) Thus, we conclude that PCaP1 is myristoylated at Gly2 and that cotranslational myristoylation anchors the protein to the membrane N-myristoylation is catalysed by two enzymes, namely ... tains a candidate for the myristoylation signal at the N-terminal region, and investigated this Biochemical analyses, including in vitro myristoylation, demonstrated the N-myristoylation of PCaP1 ... of the attachment of PCaP1 to the membrane It has been shown that the attachment to the membrane is stable under physiological conditions (Fig 8), and that Ca2+ ⁄ CaM regulates the association...
- 16
- 424
- 0