0

protocol for the use of a silica nanoparticle enhanced microcantilever sensor based method to detect hbv at femtomolar concentrations

Báo cáo nghiên cứu khoa học

Báo cáo nghiên cứu khoa học " IMPROVING CAPABILITY FOR ASSESSING SOIL CONSTRAINTS USING THE SCAMP DECISION SUPPORT SYSTEM " docx

Báo cáo khoa học

... ratios of SCAMP treatments and Farmer Practice applied to maize at Gia Lai (Ferralsol) and Tay Ninh (Acrisol) 205 Collaboration for Agriculture and Rural Development (CARD) Program Documentation ... treatments with local farmer practice Maize was grown at both sites SCAMP treatments (balanced fertilisation using fertiliser ‘straights’ such as FMP and urea, and the application of locally available ... such an approach be adopted in Vietnam as a national agricultural initiative SCAMP assessment of local soils in association with a mobile lab to undertake analyses on farmer samples has tremendous...
  • 4
  • 318
  • 0
The factors affecting user?s satisfaction in using the Customer Management Information System at Vietnam?s Northern Power Corporation (NPC)

The factors affecting user?s satisfaction in using the Customer Management Information System at Vietnam?s Northern Power Corporation (NPC)

Anh ngữ phổ thông

... Companies Integrate all customer management information in a shared database integrated into other systems such as financial accounting, revenues at the counter (QMS), power charge through the banking ... Quality CMIS User Satisfaction Research Hypotheses H1: System Quality of CMIS has a positive effect on User Satisfaction H2: Information Quality of CMIS has a positive effect on User Satisfaction ... Oral defense application Thesis oral defense Thesis revised, finalized and uploaded 05 15 Graduation Ceremony Proposal of master thesis Advisor assigned Contact with advisor Advisors approval of...
  • 21
  • 877
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Optimization of in situ hybridization assay using nonradioactive DNA probes for the detection of canine erpesvirus (CHV) in paraffin-embedded sections" pdf

Báo cáo khoa học

... Kim Table Comparison of different protocols for the detection of canine herpesvirus DNAs in paraffin sections by in situ hybridization Labelsb Protease Kc Hybridizationd 100 Titer of inoculated ... consisted of the changes of enzyme -concentrations, the time of hybridization and hybridization probes, were compared in formalin fixed and paraffin embedded CHV-infected cells The optimum result was ... was revealed that the overnight hybridization protocol resulted in the increasing sensitivity as compared with hourshybridization protocol Digoxigenin-labeled probe was capable of detecting CHV...
  • 3
  • 301
  • 0
Learning DebianGNU Linux-Chapter 6: Using the X Window System

Learning DebianGNU Linux-Chapter 6: Using the X Window System

Hệ điều hành

... 6.10: Creating a launcher applet You can specify a name for the launcher, a comment, and the command that GNOME executes to launch the application GNOME will automatically provide a default icon, ... main panes Its appearance and operation resemble that of the file manager The left pane of the menu editor hierarchically displays the menu tree, whereas the right pane shows information pertaining ... such as Kfract, a fractal generator, and Kview, an image viewer  Multimedia applications such as Kmix, a sound mixer, and Kmedia, a media player  Network applications such as Kmail, a mail client,...
  • 34
  • 298
  • 0
Tài liệu Lab 5.1.3 Using the Boot System Command pptx

Tài liệu Lab 5.1.3 Using the Boot System Command pptx

Quản trị mạng

... Show information about the Flash memory device a Enter show flash at the router prompt The router will respond with information about the flash memory and what IOS image file(s) are stored there ... look at the interfaces This will identify the type of router as well as how many interfaces the router has There is no way to effectively list all of the combinations of configurations for each ... router may contain one An example of this might be an ISDN BRI interface The string in parenthesis is the legal abbreviation that can be used in IOS command to represent the interface 5-5 CCNA 2:...
  • 5
  • 395
  • 0
Tài liệu Lab 5.1.3 Using the Boot System Command doc

Tài liệu Lab 5.1.3 Using the Boot System Command doc

Quản trị mạng

... information about the flash memory and what IOS image file(s) are stored there b Document the following information c How much flash memory is available and used? _ d What is the ... Show information about the backup configuration file a Enter show startup-config at the router prompt The router will display information on the backup configuration file stored in NVRAM b Is the ... interfaces the router has There is no way to effectively list all of the combinations of configurations for each router class What is provided are the identifiers for the possible combinations of interfaces...
  • 5
  • 351
  • 0
Tài liệu Network Application Security Using The Domain Name System pptx

Tài liệu Network Application Security Using The Domain Name System pptx

An ninh - Bảo mật

... exists to this date On the other hand, the Domain Name System provides the flexibility to allow us to store any data attached to a domain name For example, it can attach “certificate” data to a domain ... store data in generic databases The information can be updated in the database, and trigger automatic generation of zone files Simply put, the DNS protocol was not designed for remote data updates ... something all email application need to Thus DNS is already an integral part of email applications today The costs of adding support in the application to be able to look up other data are small And...
  • 109
  • 762
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Question Answering System in the Web using the Web" doc

Báo cáo khoa học

... passage, the user navigates to the document from which the passage was extracted This enables the user to check whether the answer is appropriate or to find more information related to the formulated ... not desired for the question Qual é a capital da Eslováquia? (What is the capital of Slovakia?) and should be discarded A filter that rejects answers included in a list of “undesired answers” This ... scored candidate answers that manage to go through all the previously described filters There is a final step in the algorithm where the system searches for longer answers These are answers that include...
  • 4
  • 454
  • 0
CEEH Scientific Report No 3: Assessment of Health­Cost Externalities of Air Pollution  at the National Level using the EVA Model System  docx

CEEH Scientific Report No 3: Assessment of Health­Cost Externalities of Air Pollution  at the National Level using the EVA Model System  docx

Điện - Điện tử

... (anthropogenic: GEIA/EDGAR; NEC-II + natural international ship traffic as All/15 for the year 2020) Appendix A Figure A1 A2 A3 A4 A5 A6 A6 A8 A9 A1 0 A1 1 -A1 3 A1 4 A1 5 A1 6 A1 7 A1 8 A1 9 A2 0 -A2 2 A2 3 ... sectors The essential idea behind the EVA system is that state -of -the- art scientific methods are used in all the individual parts of the impact-pathway chain and to make the best scientific basis ... systems, our goal has been to apply state -of -the- art methodologies, models and data in every link of the impact pathway chain and to develop a new method for the calculation of the contribution...
  • 98
  • 634
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Neurorehabilitation using the virtual reality based Rehabilitation Gaming System: methodology, design, psychometrics, usability and validation" pot

Hóa học - Dầu khí

... update of the game parameters that can apply to all patients Thus, the objective would be that the performance of the paretic arm equals that of the nonparetic one at the end of the treatment For ... (PTM) that automatically adjusts the difficulty of the task with respect to the measured performance of a subject Finally, RGS, as any other VR based rehabilitation approach, assumes that training ... this reason we used the data of the nonparetic arm to fit the model because it represents an age matched approximation of the desired treatment outcome We found that the correlation of the patients’...
  • 14
  • 498
  • 0
luận văn Toxicity assessment of small molecules using the zebrafish as a model system

luận văn Toxicity assessment of small molecules using the zebrafish as a model system

Tổng hợp

... TACCCTCCTTGCGCTCAATC GCGATTCCTTTTGGAGAAGAC TCGATATCCACATCGTCAGC CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC Subsequently, cDNA was amplified using the SensiMix ... an order of magnitude and toxicity classification was the same for all three chemicals (Cat.2 for DCA and non-aquatoxic for the other two), given the well-known fact in toxicology that even the ... to the onset of darkness with a strong startle, causing a maximal peak on the speed actogram, then their speed decreased as they adapted to darkness The habituation effect can also be seen as the...
  • 58
  • 262
  • 0
Survey of cellular factors modulating the HIV 1 integration complex activity using a unique protein screening system in vitro

Survey of cellular factors modulating the HIV 1 integration complex activity using a unique protein screening system in vitro

Kỹ thuật - Công nghệ

... (refer to protocol described in 2.5.1) An additional PCR was performed using a common set of forward (5’GGGGACAAGTTTGTACAAAAAAGCAGGCTgcgaattcatcgatagatctgat-3) and reverse (5’GGGGACCACTTTGTACAAGAAAGCTGGGTCctacttgtcatcgtcatccttg-3’) ... PIC for h at 37°C before addition to microtiter plate for in vitro PIC integration assay The subsequent steps of the PIC assay and qPCR, as well as method of data analysis are similar to that ... protein, HDAC1 (Allouch et al., 2011) Hence, it was proposed that KAP1 could play the role of a scaffolding mediator that recruits HDAC to acetylated IN, causing the deacetylation of the latter and...
  • 125
  • 395
  • 0
AN1024   PKE system design using the PIC16F639

AN1024 PKE system design using the PIC16F639

Cao đẳng - Đại học

... antenna should be tuned to the carrier frequency of the base station The loop antenna is made of a coil (inductor) and capacitors that are forming a parallel LC resonant circuit The voltage across ... orthogonally on the same PCB board This increases the probability that at least one of the transponder antennas faces toward the base station antenna at a given incident during application Figure ... across the antenna is also maximized by increasing the surface area of the loop and quality factor (Q) of the circuit In Equation 2, the quality factor (Q) is a measure of the selectivity of the...
  • 26
  • 408
  • 0
Expert Service Oriented Architecture in C Sharp  Using the Web Services Enhancements

Expert Service Oriented Architecture in C Sharp Using the Web Services Enhancements

Kỹ thuật lập trình

... an X.509 certificate The WSE 2.0 Toolkit automatically validates incoming and outgoing messages against the established policy frameworks, and automatically generates SOAP exceptions for invalid ... levels of reliability and scalability because they can be stored, and the services that process the messages can append additional information, which provides for a clear and unambiguous chain of ... Hiroshi Maruyama (IBM), Anthony Nadalin (IBM, editor), Nataraj Nagaratnam (IBM), Paul Patrick (BEA), Claus von Riegen (SAP), and John Shewchuk (Microsoft) Whitepaper (December 2003) Located at MSDN...
  • 336
  • 841
  • 2
The UNIX Time Sharing System

The UNIX Time Sharing System

Hệ điều hành

... command to the input of another A sequence of commands separated by vertical bars causes the shell to execute all the commands simultaneously and to arrange that the standard output of each command ... system to search the root for directory alpha, then to search alpha for beta, finally to find gamma in beta gamma may be an ordinary file, a directory, or a special file As a limiting case, the name ... open(name, flag) -5- where name indicates the name of the file An arbitrary path name may be given The flag argument indicates whether the file is to be read, written, or ‘‘updated,’’ that is, read and...
  • 15
  • 942
  • 0
Shop Manual & ETM BCM KIA Cerato 2010 - Auto Lighting Control System

Shop Manual & ETM BCM KIA Cerato 2010 - Auto Lighting Control System

Cơ khí - Chế tạo máy

... range of this supply and raises up a failure as soon as the supply’s voltage is out of range Then this failure occurs and as long as this is present, the head lamp must be turned on without taking ... Inspection In the state of IGN1 ON, when multi function switch module detects auto light switch on, tail lamp relay output and head lamp low relay output are controlled according to auto light sensor' s ... 0.05V OFF 2.7 ± 0.05V 2.7 ± 0.05V Removal Disconnect the negative (-) battery terminal Remove the photo & auto light sensor (A) from crash pad upper side by using screw (-) driver Remove the auto...
  • 5
  • 465
  • 2
USING THE ANALYTIC HIERARCHY PROCESS APPROACH FOR ASSESSMENT OF THE STRENGTH OF UNIVERSITY-INDUSTRY-GRI COOPERATION IN VIETNAM

USING THE ANALYTIC HIERARCHY PROCESS APPROACH FOR ASSESSMENT OF THE STRENGTH OF UNIVERSITY-INDUSTRY-GRI COOPERATION IN VIETNAM

Kinh tế - Thương mại

... importance of these criteria apart from any alternatives they may be considering Related to this are situations where they have ranked their alternatives by assuming that the ones they are aware of ... the qualitative measurement rather than quantitative measures The qualitative aspects of the problem is to be resolved prior to the application of quantitative assessment in the conflicts and controversy ... pre-formulated questionnaire was administered to the people who were then asked to rate relative importance of factors and alternatives The questionnaire used was patterned after Grizzle [60] and a partial...
  • 73
  • 495
  • 2
Thể dục Tiết 30

Thể dục Tiết 30

Thể dục

... đ a hình tự nhiên - Chạy liên tục cự li 400 1500m ( tuỳ theo thứ tiết ) thở chạy 3.Củng cố: - Kĩ thuật chắn bóng, đập C Phần kết thúc - Thả lỏng dũ chân tay kết hợp thở sâu - Nhận xét học - Ra ... xét học - Ra tập nhà + Chống đẩy nam 30l x 2- tổ nữ 25l x - tổ - GVnêu tập, học sinh thực động tác - GV nhận xét cho điểm - GV tổ chức cho học sinh luyện tập theo đội hình - Gv tổ chức cho h/s ... hìng IV Rút kinh nghiệm - GV gọi 2HS HS yếu lên thực Lớp quan sát ,so sánh - Gv nhận xét, rút kinh nghiệm chung - Học sinh tự thả lỏng sau lần thực động tác - Gv nhận xét u, khuyết điểm - Dặn học...
  • 2
  • 366
  • 0
You can draw in 30 days (bạn có thể vẽ trong 30 ngày!)

You can draw in 30 days (bạn có thể vẽ trong 30 ngày!)

Mỹ thuật

... gian, tàu vũ trụ thoi NASA, tàu thám hiểm h a nhiều sinh viên khác tham gia vào dự án lớn Shrek, Madagascar, Flushed Away, the Incredibles, Happy Feet A bug's Life Nhưng bí mật - học học mà vẽ ... học, ngày, đ a điểm Sau vẽ hai điểm cách đoạn 2 Dùng bàn tay không cầm bút chì bạn, để đầu ngón tay hai điểm hình, sau dùng bút vẽ hai điểm cách đầu ngón tay bạn đoạn hình Cố gắng giữ hai điểm vẽ ... xác định khối cầu xa Nó xuất dưới, sau vật thể gần Ví dụ, đan hai tay bạn vào trước mặt bàn Quan sát kĩ bạn thấy khoảng bóng tối nhỏ hình thành đường bao ngón tay khớp ngón tay Trong nháp bạn,...
  • 330
  • 5,602
  • 41

Xem thêm