proteins the definitive role of golgi associated brefeldin a bfa resistant gef 1 gbf1 in coronavirus infection has been established for mhv 240 and sars cov gbf1 was one of the strongest
Host viral interactions host factors in coronavirus replication and coronaviral strategies of immune evasion
... protein of approximately 15 0 -18 0kDa S protein contains a large N terminal ectodomain, followed by a transmembrane domain and finally a short C terminal endodomain Post-translational cleavage of the ... Yoshiyuki Yamada, Dr Nasirudeen AMA, Dr Pankaj Kumar, Dr Samuel Wang, Dr Alexandre Chaumet and Dr Germaine Goh for their help and advice I would also like to thank IMCB (A* STAR) for awarding me the ... cellular cofactors that have roles in modulating coronavirus replication In the second part of the thesis, we focused on understanding the interplay between coronavirus infection and host cell innate...
- 220
- 328
- 0
Báo cáo khoa học: Two conserved domains in regulatory B subunits mediate binding to the A subunit of protein phosphatase 2A pdf
... 5 51 Fig Binding of the two conserved domains in Ba and PR72 to the A subunit of PP 2A Fragments of rat Ba and human PR72 encompassing ASBD and were tested for binding to GST and GST -A by incubation ... conserved A subunit-binding domains (ASBD and ASBD 2) in human B5 6a, rat Ba, and human PR72, highlighted in gray information for further elucidating the structural basis of interactions in the PP 2A holoenzyme ... to a high level of nonspeci®c adsorption of the B5 6a polypeptides to the beads, and suboptimal binding in the absence of cotranslation of the A and C subunits The smallest N-terminal fragment of...
- 7
- 550
- 0
The natural history of non-alcoholic fatty liver disease in children: a follow-up study for up to 20 years pptx
... December 19 99 The date January 19 85 was chosen since the first case of paediatric NAFLD was reported in the mid 19 80s;20 the date 31 December 19 99 was chosen to have a 15 year ascertainment period and ... age and sex in each individual case {Includes the normal laboratory values for boys and girls for the age range of our patient population {Based on percentile for age and sex ALT, alanine aminotransferase; ... intervals thereafter Laboratory evaluation included liver biochemistries (serum aspartate aminotransferase (AST), alanine aminotransferase (ALT), alkaline phosphatase activity, c-glutamyl transferase...
- 7
- 487
- 0
Báo cáo sinh học: " HBx M130K and V131I (T-A) mutations in HBV genotype F during a follow-up study in chronic carriers" potx
... TATTAGGAGGCTGTAGGCA 6541m_27-0 CAGGTtAAA TATTAGGAGGCTGTAGGCA 6290m _12 32 CAGGTTAAA TATTAGGAGGCTGTAGGCA 467h_969-0 CAGGttAAA TATTAGGAGGCTGTAGGCA Consensus CAGGTTAAATATTAGGAGGCTGTAGGCA ... 10 and 11 , sample 65 41 lanes 12 and 13 The samples 467 and 6 516 treated with SspI presented two bands of 507 and 10 9 bp, lanes and 10 (arrows) confirming the deletion Details in sequence are: ... reading frame, changing K130N and introducing an iso- Many efforts have been made in order to clarify the role of viral variants in the pathogenesis of HBV infection; and still there is no final consensus...
- 10
- 438
- 0
báo cáo hóa học:" HBx M130K and V131I (T-A) mutations in HBV genotype F during a follow-up study in chronic carriers" pdf
... TATTAGGAGGCTGTAGGCA 6541m_27-0 CAGGTtAAA TATTAGGAGGCTGTAGGCA 6290m _12 32 CAGGTTAAA TATTAGGAGGCTGTAGGCA 467h_969-0 CAGGttAAA TATTAGGAGGCTGTAGGCA Consensus CAGGTTAAATATTAGGAGGCTGTAGGCA ... 10 and 11 , sample 65 41 lanes 12 and 13 The samples 467 and 6 516 treated with SspI presented two bands of 507 and 10 9 bp, lanes and 10 (arrows) confirming the deletion Details in sequence are: ... reading frame, changing K130N and introducing an iso- Many efforts have been made in order to clarify the role of viral variants in the pathogenesis of HBV infection; and still there is no final consensus...
- 10
- 359
- 0
báo cáo hóa học:" Impact of recent life events on the health related quality of life of adolescents and youths: the role of gender and life events typologies in a follow-up study" potx
... study was children and adolescents aged 8 -18 The aim was to recruit a sample that was representative by gender and age in each participating country according to census data Telephone sampling was ... computed for each dimension and for the overall score and are transformed into T-values with a mean of 50 and standard deviation (SD) of 10 The T scores refer to the mean values and SD from a representative ... Barcelona, Spain 3Agency for Health Information, Assessment and Quality, Barcelona, Spain 4NIHR School for Primary Care Research, Department of Primary Care, Division of Primary Care and Public Health,...
- 9
- 583
- 0
Báo cáo khoa học: "Chromosomal radiosensitivity and acute radiation side effects after radiotherapy in tumour patients a follow-up study" ppsx
... acquisition and interpretation of data; he has been involved in drafting the manuscript and has contributed to the final version to be published HB has made substantial contributions to the conception and ... design of the study, to analysis and interpretation of the study He was responsible for the statistical treatment of data, kindly delivering the manuscript’s Figures He was involved in drafting the ... supervised the administration and delivery of patients’ blood samples He has been involved in revising the manuscript critically and has given final approval of the version to be published IJ has made...
- 8
- 405
- 0
báo cáo khoa học: "Long-term follow-up after en bloc resection and reconstruction of a solitary paraganglioma metastasis in the first lumbar vertebral body: a case report" ppt
... demonstrated a thinly encapsulated neoplasm The diagnosis of a paraganglioma was confirmed by histologic and immunohistologic examinations Because vascular invasion and focal infiltration of the ... diphosphonate) and I -12 3-MIBG (12 3 I-metaiodobenzylguanidine) scintigraphy was performed 10 and 21 days postoperatively An increased uptake in the first lumbar vertebra was noted and MRI showed a lesion ... retroperitoneal space Paragangliomas arising from carotid bodies appear to have the highest propensity for metastatic spread to the spine [1] The retroperitoneal extra-adrenal paraganglioma is the...
- 6
- 323
- 0
Báo cáo y học: " Change in quality of life and their predictors in the long-term follow-up after group cognitive behavioral therapy for social anxiety disorder: a prospective cohort study" pptx
... situation a a a a -0.32** a a a a a a a a a a a a a a a a a a a Employment a a a a a a a a a a a a -0.30* a a a a a a a a a a a Generalized SAD -0.22* a a a a a a -0.28* a a a a a a a a a a a a a ... a a a a Benzodiazepine use 0.23* a a a a a a a a a a a a a a a a a a a a a a a SPS (total) a a a a a a a a a 0.39* a 0.29* a a a a a a a a a 0.49** a a SIAS (total) SCL-90-R depression a a a a ... depression a a a a a -0.44** a a a a a a a a a a a a a -0.64** a a a a a a a a a -0.46** a a a a a a a a a a a a -0.32* -0. 41* a -0. 61* * a a Adjusted R-square Table shows the standardized Beta coefficients,...
- 10
- 388
- 0
Báo cáo y học: " Use of dietary supplements in Olympic athletes is decreasing: a follow-up study between 2002 and 2009" doc
... study years was seen in all subgroups except for amino acids (3.8% in 2002 and 7.3% in 2009), oils and fatty acids (11 % and 19 %), Heikkinen et al Journal of the International Society of Sports ... declared on the label Most of the contaminated supplements (68 .1% ) contained prohormones of testosterone and contamination was found in all kinds of NS [18 ] Baume et al found similar results in their ... for Anabolic-Androgenic Steroids - Results of an International Study Int J Sports Med 2004, 25 :12 4 -12 9 19 Alaranta A, Alaranta H, Palmu P, Alha P, Pietila K, Heliovaara M, Helenius I: Asthma Medication...
- 8
- 238
- 0
Báo cáo y học: "Bone mineral density in partially recovered early onset anorexic patients - a follow-up investigation" docx
... SS and PS carried out the investigation US and PS created and edited the drafts, SS and PS did the main part of data analysis CMW revised the draft critically All authors approved the final manuscript ... A 2-year prospective study of bone metabolism and bone mineral density in adolescents with anorexia nervosa J Neural Transm 2007, 11 4 :16 11- 1 618 27 Diamanti A, Bizzarri C, Gambarara M, Calce A, ... regulators of bone homeostasis and one of the factors required to Page of 11 achieve normal longitudinal bone growth and bone mass In adults, they are essential for bone maintenance [5] The IGF-I...
- 11
- 358
- 0
Báo cáo y học: "The influence of behavioural and health problems on alcohol and drug use in late adolescence - a follow up study of 2 399 young Norwegians" pptx
... during the last decades; in particular binge drinking and cannabis use has grown [1- 3] Alcohol and drug use in adolescence has been associated with several classes of health problems: externalizing ... often Factor analyses revealed two factors with eigenvalue >1 “Having trouble concentrating in class” and “Can not manage to be calm in class” indicating attention problems, and “Arguing with the ... than forced into the same model Even if the behavioural and Strandheim et al Child and Adolescent Psychiatry and Mental Health 2 011 , 5 :17 http://www.capmh.com/content/5 /1/ 17 Page of Results A...
- 9
- 343
- 0
The case for rentierism as a cause forunderdevelopment in malaysia tourism planning from mahathir to the present day
... ‘marked a Malay coming of age.’80 The Mahathir Years Baker describes Mahathir as having been 'in tune with the younger ascendant capitalist Malays and being 'in the vanguard of a group that was ... what information was required rather than seeing what was available Pulau Langkawi is a small island and the list of hotels was short As such, only nine interviews were conducted .14 The main ... Chart 3 .1 : Growth rate in Malaysia (percent increase or decrease in GDP) 15 2007 2005 2003 20 01 1999 19 97 19 95 19 93 19 91 1989 19 87 19 85 19 83 19 81 1979 19 77 19 75 19 73 19 71 1969 19 67 19 65 19 63 19 61...
- 256
- 556
- 0
Applying task based approach in teaching english grammar to the 1st year non english majors at ho chi minh university of industry, nghe an branch luận văn thạc sĩ giáo dục học
... of Grammar There have been various ways of defining grammar - a very common and familiar term in language teaching and learning According to Luu Quy Khuong (2006), in the old days, grammar was ... Together with the growing demand for learning English, there has been an innovation in English teaching and learning methods everywhere in Vietnam For a long time, language teaching in Vietnam was ... serve the aforesaid aims, the research attempts to answer the following questions: What is the reality of the application of the task-based approach in teaching English grammar at HUI? What are the...
- 100
- 1,394
- 6
Conservative and Aesthetic Emergency Management in Adolescent with Complex Crown-Root Fracture and Simultaneous Oblique Root Fracture in Upper Maxillary Central Incisor: Clinical Outcome after 18 Months Follow-up Period docx
... 5 :11 1- 31, 19 89 Andreasen, J O & Andreasen, F M Dental trauma, quo vadis Tandlaegebladet, 93 (11 ):3 81- 4, 19 89 Andreasen, J O & Andreasen, F M Essentials of traumatic injuries to the teeth 1st ed Copenhagen, ... development of pulp obliteration (Rodd et al., 2007; Andreasen et al., 200 7a; Andreasen, 19 89; Andreasen et al., 19 88) The complementary examination of teeth affected by dental trauma and the complications ... knowledge and approach for a correct case planning and prognosis However, our intention in this case was to perform a conservative and minimally invasive therapy, given that the accident had occurred...
- 11
- 423
- 1
Báo cáo y học: "Proximal myopathy in lacto-vegetarian Asian patients responding to Vitamin D and calcium supplement therapy - two case reports and review of the literature" ppt
... sedimentation rate and an auto-antibody screen were all normal Plain film radiography and isotope bone scans showed no abnormality As in the first case, a diagnosis of osteomalacia was made based ... Hospital, Dublin, Ireland Authors’ contributions HT was responsible for data analysis, the literature search and preparation of the manuscript MB participated in the data analysis and contributed in ... of vitamin D Page of appear to be the main causes of osteomalacia [4,5] The occurrence of osteomalacia can also be related to varying degrees of vegetarianism Lacto-vegetarians (vegetarian diet...
- 3
- 285
- 0
Báo cáo y học: "The long-term prediction of return to work following serious accidental injuries: A follow up study" docx
... stress, appraisal and coping [13 ,23] Lazarus emphasized the significance of the primary and secondary appraisal of a stressful situation In the primary appraisal the situation can be judged as harmful, ... sickleave days taken the sample was divided into four groups based on the median values for appraisal of injury severity and of coping abilities (Figure 1) The median for both variables was Likert ... the mean age was 37.7 (SD = 12 .4) years The mean ISS was 22.2 (SD = 10 .3) More detailed information with Page of regard to clinical parameters of the sample has been published in a previous article...
- 7
- 299
- 0
báo cáo khoa học:" A ‘short walk’ is longer before radiotherapy than afterwards: a qualitative study questioning the baseline and follow-up design" potx
... redefinition of the target construct), change in sampling strategy and combinatory algorithm to reprioritization (a change in individual’s values), and change in standards of comparison to recalibration ... items For example, a patient may use the same standards of comparison over time in answering three items, and may use a variety of different standards of comparison in the other four Moreover, the ... (MEC) of the AMC provided exemption from seeking formal approval, as is standard practice for such studies Data analysis Qualitative analysis of all interviews was independently carried out by the...
- 12
- 230
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25