protein structure and kinetics of enzyme reactions a historical perspective
Kinetics of Enzyme Reactions
... Ternary-complex mechanism Random mechanism Two substrates A and B can bind in any order P,Q - products Ordered mechanism Binding of A is required before B can bound Ping-pong mechanism Substrate A reacts with ... the active site ⇒ deactivation of ezyme eg inhibition of acetylcholine esterase Penicillin inhibits bacterial transpeptidase Control of enzyme activity Allosteric enzymes Negative feedback ... / ] - amount of enzyme that convert µmol substrate per 1min SI unit Katal (kat) [mol /s] - amount of enzyme that convert mol substrate per 1s Factors which effect enzyme activity temperature...
- 16
- 320
- 0
Báo cáo khoa học: Evolutionary changes to transthyretin: structure and function of a transthyretin-like ancestral protein doc
... Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Betaproteobacteria Proteobacteria, Betaproteobacteria Proteobacteria, ... Betaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria 2 2 2 2 ... Chromohalobacter salexigens DSM3034 Acinetobacter sp (strain ADP1) Pseudomonas fluorescens Pf5 ATCC BAA-477 Actinobacteria, Actinobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria...
- 13
- 390
- 0
Báo cáo khoa học: Functional aspects of the solution structure and dynamics of PAF – a highly-stable antifungal protein from Penicillium chrysogenum pdf
... opafK35,38Ase opafK35,38Arev opafK9Ase opafK9Arev GGAAAATGCACCGCTTCTAAGAACG CGTTCTTAGAAGCGGTGCATTTTCC GTTTGATAACAAGGCTTGCACCAAGG CCTTGGTGCAAGCCTTGTTATCAAAC GAAGTGCACCGCTGATAATAACAAATG CATTTGTTATTATCAGCGGTGCACTTC ... CATTTGTTATTATCAGCGGTGCACTTC GTTTGATAACAAGGCTTGCACCGCTG CAGCGGTGCAAGCCTTGTTATCAAAC GGAAAATGCACCGCTTCTAAGAACG CGTTCTTAGAAGCGGTGCATTTTCC pPic9Kmpaf pPic9Kmpaf pPic9Kmpaf pPic9KpafK3 8A pPic9KpafK35,3 8A FEBS ... (Table ) Loop (9–12) and loop (18–23) create a b-turn A characteristic of the PAF loop regions is the recurring asparagine–aspartate or aspartate–asparagine (Asn18– Asp19, Asp32–Asn33, Asp39–Asn40)...
- 16
- 408
- 0
Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx
... dendrite arborization patterns that are critical for shaping neuronal circuits, and also may provide a clue to the understanding of some MAP2-associated neurodegenerative and psychiatric disorders ... (catalog number: SC-9996; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), Flag (catalog number: 3165; Sigma-Aldrich) and HA (catalog number: 1867423; Roche Diagnostics, Basel, Switzerland) ... region of MAP2 CD2 domain (702–744 aa) in human, mouse and Gallus This supplementary material can be found in the online version of this article Please note: As a service to our authors and readers,...
- 11
- 658
- 0
Tài liệu Báo cáo khoa học: a-Conotoxins as tools for the elucidation of structure and function of neuronal nicotinic acetylcholine receptor subtypes doc
... subunits and a- BTX distinguished two major classes of nAChRs: a major population of a- BTX binding a7 * nAChRs which is mainly localized perisynaptically, and a less abundant population of a3 * nAChRs ... investigation and understanding of their structure- activity relationships, may start to provide a rational way to develop additional pharmacological tools for the elucidation of nAChR structure and ... characterization of a range of GIC and GID native nAChRs (Table 1) Because of its relatively slow Two neuronally active a4 /7-conotoxins, GIC and GID, dissociation kinetics, MII is suitable as a radioligand An...
- 15
- 757
- 0
Tài liệu Báo cáo Y học: A Raman optical activity study of rheomorphism in caseins, synucleins and tau New insight into the structure and behaviour of natively unfolded proteins pot
... signi®cantly The backscattered Raman and ROA spectra of the wild-type and mutant tau46 are shown as the top and bottom pairs, respectively, in Fig Both ROA spectra show a strong positive ROA band ... the acquisition of ROA data of suf®cient quality for reliable analysis A ROA spectrum of rather poor quality of an impure commercial sample of a- casein (composition unde®ned) was reported in an ... backscattered Raman and ROA spectra of recombinant wild-type human a- synuclein (top pair) together with those of the A3 0P (middle pair) and A5 3T (bottom pair) mutants at pH 7.2 All three ROA...
- 9
- 667
- 0
Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf
... helices AV and BV at the surface of domain V Gly621 and Gly617 are in the area of contact with the 1095 and 2473 regions of 23S RNA The two helices are facing the ribosome, and the four-stranded ... Helgstrand M, Mandava CS, Mulder FA, Liljas A, Sanyal S & Akke M (2007) The ribosomal stalk binds to translation factors IF2, EF-Tu, EF-G and RF3 via a conserved region of the L12 C-terminal domain ... and Crystal structure of Staphylococcus aureus EF-G Carl Trygger’s Foundation to M Selmer and S Sanyal, the Goran Gustafsson Foundation to S Sanyal, ¨ and Magnus Bergvall’s foundation and the...
- 15
- 474
- 0
Báo cáo khoa học: Kinetics of enzyme acylation and deacylation in the penicillin acylase-catalyzed synthesis of b-lactam antibiotics pptx
... and 6-APA using PAA and PGA However they observed in all cases a saturation of the (Vs/Vh)max, whereas our data indicate a linear relation for the combinations of 7-ADCA/PGA and 6-APA/PAA Since ... p-NPA For NIPGB and NIPAOB, the final enzyme concentration was lM and substrate concentration was 10ÆKm For p-NPA the final enzyme concentration was lM and substrate concentration was 400 lM faster ... KNapp for 7-ADCA may be caused by a lower affinity of the enzyme for 7-ADCA compared to 6-APA or it could be that binding of 7-ADCA to the acyl -enzyme lowers the kh2 more than binding of 6-APA...
- 9
- 518
- 1
Báo cáo khóa học: S-(2,3-Dichlorotriazinyl)glutathione A new affinity label for probing the structure and function of glutathione transferases potx
... PCRs were as follows: Phe51Ala mutation, 5¢-CGGAACCCCGCAGGTCGAGTTTCC-3¢ and 5¢-GA CGAGGTGCTCGGGGCTCTT-3¢; Met121Ala mutation, 5¢-ATCAGTCCGGCACTTGGGGGAACC-3¢ and 5¢-GAGGACGTCGAAGAGGATGGGTTACAG-3¢ ... 26.67 A2 and 49.26 A2 , and the ˚ and 79.30 A2 , respect˚ B-factors of S atoms are 38.14 A ively It is therefore reasonable to propose that conformational changes and changes in dynamics may also ... residual activity of the partial active enzyme intermediate, and kfast and kslow are A nity labelling of maize GST I (Eur J Biochem 271) 3505 the rate constants for the slow and fast phase of the...
- 9
- 556
- 0
Báo cáo khoa học: Effect of mutations in the b5–b7 loop on the structure and properties of human small heat shock protein HSP22 (HspB8, H11) pptx
... both at neutral [32] and alkaline pH [33], the wild-type HSP22 and its mutants migrated as a single band with an apparent molecular mass of approximately 60 kDa (data not shown), thus indicating ... the same time, the K137E mutant of HSP22 was eluted as a broad peak with a trailing end, with a Stokes radius and apparent ˚ molecular mass of 28.2 A and 43.9 kDa, respectively (Fig 3A) Taking ... of their peaks was similar to that of the wild-type HSP22 The Stokes radii and apparent molecular masses of the ˚ K141E and K137,141E mutants were similar: 26.7 A and 37.9 kDa (Fig 3A) [29] At...
- 15
- 431
- 0
Báo cáo Y học: Thermodynamics and kinetics of the cleavage of DNA catalyzed by bleomycin A5 A microcalorimetric study pdf
... self-inactivation of the enzyme into account It is a novel application of the thermo-analytical analog curve method and suitable to both fast and slow enzymecatalyzed reactions A plot of –ln(1 ... cleavage of calf thymus DNA induced by BLM -A5 and those for the scission of calf thymus DNA mediated by two DNA-damaging agents, ADM and (1,10-phenanthroline)-copper Data are expressed as mean ... cleavage of calf thymus DNA by a mixture of BLM -A5 , Fe2+ and O2 at 37.0 °C The thermodynamic and kinetic data were obtained from the analog calorimetric curve model of a single-substrate enzyme- catalyzed...
- 9
- 464
- 0
Báo cáo khoa học: Structure and function of human a-lactalbumin made lethal to tumor cells (HAMLET)-type complexes pptx
... oleic acid [2] The complex was named HAMLET and was defined as a complex between partially unfolded a- lactalbumin and oleic acid Human a- lactalbumin is a globular 14.2 kDa milk protein (123 amino acids), ... side chains of asparagines 82, 84, 87 and 88 and lysine 79 [14] The a- helical domain contains three major ahelical (amino acids 5–11, 23–34 and 86–98) and two short 310-helical domains The smaller ... Hospital Foundation, Royal Physiographic Society, Anna-Lisa, Sven-Erik Lundgren Foundation, Knut and Alice Wallenberg Foundation, Inga-Britt and Arne Lundbergs Foundation and the John and Augusta...
- 12
- 525
- 0
Báo cáo khoa học: Structure and function of the 3-carboxy-cis,cis-muconate lactonizing enzyme from the protocatechuate degradative pathway of Agrobacterium radiobacter S2 pdf
... via the catechol and protocatechuate branches of the 3-oxoadipate pathway [1,2] In the protocatechuate branch of the 3-oxoadipate pathway, protocatechuate is initially oxygenolytically cleaved ... demonstrated that the PpCMLE belongs to the fumarase II family of enzymes, which also includes class II fumarase, aspartase, adenylosuccinate lyase, argininosuccinate lyase and d-crystallin All these enzymes ... intermedia S1 and A radiobacter S2 that take part in the degradation of 4-sulfocatechol by a modified version of the 3-oxoadipate pathway (they are part of the sulfocatechol gene cluster) [15] These enzymes...
- 14
- 326
- 0
Báo cáo khoa học: Proteome analysis of a rat liver nuclear insoluble protein fraction and localization of a novel protein, ISP36, to compartments in the interchromatin space pptx
... that associates with nuclear matrix DNA Cell Biol 17, 849–858 Lee JY, Nakane Y, Koshikawa N, Nakayama K, Hayashi M & Takenaga K (2000) Characterization of a zinc finger protein ZAN75: nuclear ... E B A A A A A A A A C A B D A A A A B A 71 47 217 42 S S M S 1 – – – 25 – B A C A 67 130 160 98 S S M M – – – 13 30 A A B B Accession no in the NCBI protein database proteins Filamentous proteins ... Thanumalayan S, Muralikrishna B, Rangaraj N, Karande AA & Parnaik VK (1999) Colocalization of intranuclear lamin foci with RNA splicing factors J Cell Sci 112, 4651–4661 11 Gueth-Hallonet C, Wang...
- 12
- 400
- 0
Báo cáo khoa học: "Comparison between the structure and function of chloroplasts at different levels of willow canopy during a growing season" ppsx
... chloroplast ultrastructure, and leaf characteristics of high- and low-light plants and of sun and shade leaves Photosynth Res 2, 115-141 light E.M (1986) Correlation of activity and amount of ribulose ... ultrastructure was analyzed from the electron micrographs as described by Aro et aL, (1986) and Vapaavuori (1986) On an average, typi- cal chloroplasts were analyzed sample of the replicate plots ... correla- N P and the ratio of the length of appressed to nonappressed thylakoid membranes (Fig 2A) and between the ratio of the length of appressed to non-appressed thylakoid membranes and photon...
- 4
- 332
- 0
báo cáo khoa học: " Simultaneous measurement of sensor-protein dynamics and motility of a single cell by on-chip microcultivation system" pps
... and Tar-localization dynamics (red squares) with chemical stimulation Time course of tumbling frequency (blue circles) and Tar-localization dynamics (red squares) with chemical stimulation Hatched ... the protein- localization dynamics and the motility for generations was developed • The decreasing and recovery of the Tar-localization in a living bacterium was monitored under environmental change ... bacterial chemotaxis: receptor dimers in signalling arrays Molecular Microbiology 1998, 30:459-466 Manson MD, Armitage JP, Hoch JA, Macnab RM: Bacterial locomotion and signal transduction J Bacteriol...
- 4
- 166
- 0
The intellectual structure and substance of the knowledge utilization field: A longitudinal author co-citation analysis, 1945 to 2004 pdf
... leadership and coordination, participated in data analysis and interpretation, drafted the final manuscript, and approved the final submitted manuscript LD conducted data analysis and made major ... JAMA-Journal of the American Medical Association 41 Research Policy 39 Medical Journal of Australia 32 International Journal of Technology Assessment in Health Care 32 Journal of the American ... Small [60], we argue that both normative and constructivist interpretations of citation patterns are valid Author co-citation analysis In ACA, cited and co-cited authors are the unit of analysis...
- 22
- 393
- 0
báo cáo khoa học: "Structure and expression of the maize (Zea mays L.) SUN-domain protein gene family: evidence for the existence of two divergent classes of SUN proteins in plants" pot
... indicates that these Arabidopsis and rice CCSD proteins are localized at the NE The presence of a C-terminal SUN domain and the NE localization are among the defining features of animal and fungal ... nuclear reorganization during meiosis, and karyogamy Results: We found and characterized a family of maize SUN-domain proteins, starting with a screen of maize genomic sequence data We characterized ... functional domains in plant and animal SUN-domain proteins Comparative diagrams of SUN-domain proteins depicting protein sizes and domain locations (see Table 2) The positions of transmembrane (red),...
- 22
- 451
- 0
báo cáo khoa học: " The intellectual structure and substance of the knowledge utilization field: A longitudinal author co-citation analysis, 1945 to 2004" potx
... leadership and coordination, participated in data analysis and interpretation, drafted the final manuscript, and approved the final submitted manuscript LD conducted data analysis and made major ... JAMA-Journal of the American Medical Association 41 Research Policy 39 Medical Journal of Australia 32 International Journal of Technology Assessment in Health Care 32 Journal of the American ... Small [60], we argue that both normative and constructivist interpretations of citation patterns are valid Author co-citation analysis In ACA, cited and co-cited authors are the unit of analysis...
- 22
- 316
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25