prompting the selection of a workspace on startup
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"
... two-tailed Spearmans coefficient (r) for non-parametric correlations A P value of less than 0.05 was regarded as significant Software package STATA 9.0 (USA) was used for the analysis Materials and Methods ... and after the initiation of NARP can be seen in table A negative correlation was observed between the ceftriaxone consumption and the prevalence of ceftriaxone resistant E.coli and Klebsiella ... financial cost and resistance patterns of leading nosocomial pathogens (gram) and number of boxes were calculated from two databases, 1) Hospital pharmacy computer databases, and 2) International...
- 6
- 692
- 0
Formation of Aerobic Granular Sludge in a Continuous-Flow Reactor – Control Strategy for the Selection of Well-Settling Granular Sludge
... Overhead view Fig - Schematic diagram of the AUFB reactor Reactor Setup and Operation for the Formation of Aerobic Granular Sludge Two AUFB reactors were used for the formation of aerobic granular ... Japan) RESULTS AND DISCUSSION Effect of Surface Loading and Aeration Rates on the Selection of Well-Settling Sludge As we expected, the increase in both surface loading and aeration rates strongly ... aerobic granulation in a continuous-flow reactor Both surface loading and aeration rates affect the selection of well-settling sludge and the formation of aerobic granular sludge By setting and controlling...
- 8
- 481
- 0
A CFD analysis on the effect of ambient conditions on the hygro-thermal stresses distribution in a planar ambient airbreathing PEM fuel cell
... membrane hydration and avoidance of water flooding in the cathode catalyst layer and/or gas diffusion layer [2] Water management is related with air supply to the cathode and is one of the crucial ... solving the steady-state Navier-Stokes equations, i.e the continuity equation, the mass conservation equation for each phase yields the volume fraction (r ) and along with the momentum equations the ... mechanical, thermal, and electrical contact between the central parts of the gas diffusion backing and Membrane-Electrode-Assembly (MEA) 2.2 Model equations 2.2.1 Air and fuel gas flow In natural...
- 16
- 727
- 0
Experimental study on the performance of a prism-shaped integrated collector-storage solar water heater
... time variation of solar radiation and average temperature of the present experimental study in August and the theoretical results of [1] in June Figure 10 The time variation of solar radiation and ... time variation of the parameter “average temperature/solar radiation” for August from the present study and the published data [1] for June Figure 14 The time variation of the parameter “average ... vertical layer of water along the tank wall Part of this heat is then transferred by diffusion towards the core of the tank The water of the vertical layer becomes lighter than its surrounding and then...
- 12
- 520
- 1
Tài liệu HOW TO MEASURE THE IMPACT OF A CRM STRATEGY ON THE FIRM PERFORMANCE doc
... evaluation settings Their major drawback of evaluation is that they focus on the estimation of cash flows and accounting criteria (Kim, Suh and Hwang, 2003) Nevertheless, traditional performance ... information systems and data warehouses been able to manage a great deal of data The challenge is to capture and measure soft and qualitative information For example, in the book The Experience Economy ... Skandia Navigator (Edvinsson and Malone, 1997) Value Chain Scoreboard (Lev, 2002) Description of measure Sets of human capital indicators are collected and bench-marked against a database Similar...
- 15
- 796
- 0
Tài liệu A Case Study on the Implementation of A Knowledge Management Strategy Oriented to Innovation pdf
... knowledge and information: that is, an interaction between actions and behaviors The action of CASE STUDY creation does not consist of the processing of information or data, since the obtaining of tacit ... interco-operation, social transformation, universal character, education The mission and corporate values summarize the corporation and the culture of all the firms belonging to it: customer satisfaction, ... will add value and establish learning as a continuous process within the organization The process of implementation of a KM strategy involves the operations of creation, storage, distribution and...
- 10
- 1,063
- 1
Tài liệu The Effects of Equipment Age on Spare Part Costs - A Study of M1 Tanks pptx
... studies have typically focused on the spare parts portion of Operation and Maintenance (O&M) accounts, because good maintenance labor hour data are lacking The lack of labor data, as well as the failure ... Studies of an Age-Cost Relationship Cost Data Are Lacking in Key Areas A critical factor hampering studies of an age-cost relationship is the lack of detailed maintenance-related data for all relevant ... Percent AMC Army Materiel Command AMDF Army Master Data File AMSAA Army Materiel Systems Analysis Activity AR Armor Regiment ARI Automatic Return Item ASL Authorized Stockage List AVN Aviation Brigade...
- 86
- 578
- 0
Tài liệu Báo cáo khoa học: Influence of modulated structural dynamics on the kinetics of a-chymotrypsin catalysis Insights through chemical glycosylation, molecular dynamics and domain motion analysis pptx
... ịt ỵ A2 expkHX;2 ịt ỵ A3 where A1 , A2 , and A3 are the fractions of the fast, slow and stable amide protons and kHX,1 and kHX,2 are the apparent exchange rate constants for the fast and slow amide ... conjugates were independent of the size of the glycan (Tables and 5, [36]) The analysis revealed that the changes in these parameters statistically correlate for both the acylation and deacylation ... that other phenomena, such as electrostatic stabilization of the transition state, formation of covalent intermediates, steric strain, near attack conformations, substrate desolvation, low barrier...
- 17
- 531
- 0
Tài liệu A PRELIMINARY ANALYSIS OF THE EFFECTS OF HR 2454 ON U.S. AGRICULTURE doc
... a regional model of the U.S agricultural sector, Lewandrowski et al examined the potential for carbon sequestration at various carbon prices At a carbon price of $34 per MT CO2e , they estimate ... grassland) Figure shows the regional breakout of the potential carbon dioxide equivalent sequestered through afforestation on cropland and pastureland and through soil management at a carbon price ... price of $34 per CO2e Figure 4—Carbon Sequestration Potential by Region (based on carbon price of $34/MT CO2e) Pacific Mountain Delta States South East Afforestation from cropland Appalachia Afforestation...
- 13
- 651
- 0
Tài liệu Biodiversity and Local Perceptions on the Edge of a Conservation Area, Khe Tran Village, Vietnam doc
... Poaceae Calamus walkeri Acacia auriculiformis Musaceae Wendlandia glabrata Licuala spinosa Tarrietia javanica Cleistanthus aff myrianthus Melocalamus compactiflorus Afzelia xylocarpa Tools The future ... occurs An old cemetery is situated in the middle of an Acacia plantation, and the remains of abandoned villages can be found around the small tree forest in the village area These land features ... Animal Pahy Latin/English LUVI Pahy/English LUVI Pheo Ki re Tràm Pe A xop A ro Huen Pa lar Tu vien Poaceae/bamboo Calamus walkeri /rattan Acacia auriculiformis/Acacia Musaceae/banana Wendlandia...
- 118
- 556
- 0
Tài liệu Báo cáo Y học: Dissecting the effect of trifluoroethanol on ribonuclease A Subtle structural changes detected by nonspecific proteases ppt
... caused by the drastically decreased rate of primary cleavage of RNase A (Fig 4), as discussed below As a consequence of the breakdown of the tertiary structure of RNase A in concentrations of trifluoroethanol ... chemicals were the purest ones commercially available Determination of RNase A concentration The protein concentration of RNase A stock solution was determined by using the molar absorption coefficient ... Fig was obtained by relating these values to the value determined for 0% trifluoroethanol Analytical ultracentrifugation Analytical ultracentrifugation was carried out on a Beckman Optima XL -A ultracentrifuge...
- 7
- 492
- 0
The impact of a cancer Survivorship Care Plan on gynecological cancer patient and health car provider reported outcomes (ROGY Care): study protocol for a pragmatic cluster randomized controlled trial potx
... for them to be blinded to the group assignment The participants on the other hand are unaware of the group assignment, as they are under the assumption that the hospital is providing usual care ... This questionnaire aims to evaluate the (satisfaction with) information received by cancer patients on different areas of the disease, diagnosis, treatment and care, and some qualitative aspects, ... information provision, and availability; the other hospital staff’s interpersonal skills and information provision scale; the exchange of information single-item scale; the waiting time; the hospital...
- 8
- 786
- 0
The effects of oxidative stress on female reproduction: a review ppt
... Harada T, Taniguchi F, Izawa M, Ohama Y, Takenaka Y, Tagashira Y, Ikeda A, Watanabe A, Iwabe T, Terakawa N: Apoptosis and endometriosis Front Biosci 2007, 12:3140–3151 111 Yamaguchi K, Mandai ... decidual hemorrhage, and maternal-fetal activation of the hypothalamic-pituitary axis, amongst others [239] Of these etiologies, intrauterine infection and inflammation is considered a main contributor ... (TNF)alpha activates the apoptotic cascade, causing cell death Conversely, the antioxidants vitamin C and E, and sulfalazine can prevent this damage by inhibiting the activation of NF-kappa B...
- 31
- 1,719
- 0
NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx
... consists of a federation of 11 states in Peninsular Malaysia and the states of Sabah and Sarawak in the north of Kalimantan Kuala Lumpur, the national capital, Labuan UNEP/SCS – National Report Malaysia ... Singapore The Straits of Malacca The Straits of Singapore The Straits of Singapore The Straits of Malacca The South China Sea The South China Sea The Straits of Singapore The Straits of Malacca The ... aim of the national report is to review existing information on the use of, and threats to, the Malaysian coastal and marine resources off the Straits of Malacca and the adjacent waters of the Andaman...
- 88
- 581
- 0
The Impact of a Corporate Culture of Sustainability on Corporate Behavior and Performance pptx
... social dynamic data supplier RepRisk Finally, SAM analysts personally contact companies to clarify any issues that may arise from the analysis of the MSA, the questionnaire, and the company documents ... governance, so that the board can form an opinion about whether management is executing the strategy of the organization well Quality, comparability, and credibility of information and whether management ... Firms: A Model of Myopic Corporate Behavior Quarterly Journal of Economics 104: 655-669 Ullmann, A A 1985 Data in search of a theory: a critical examination of the relationships among social performance,...
- 57
- 447
- 0
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc
... GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU T46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3¢); GLU H44 7A, D45 0A ... (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), GLU H44 7A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA ... et al Glucoamylase raw starch binding site reverse (5¢-GTTCATTCAAGGAGCCATCAGCATTAAT AGCATCCAAAATGACTTGC-3¢) All mutations were verified by DNA sequencing Glucoamylase Glu Enzyme preparation and...
- 11
- 548
- 0
Hollywood on the Head of a Pin: Montage and Marketing at the Oscars® docx
... overdetermines the montage’s celebration of spectatorship as accumulation and consumption Accumulation is an endemic feature of the cultural landscape of the information society, according to Scott Lash, ... literalizing the global expansion, yet significatory contraction of moving image culture under globalization The Workman montages of the 1990s pave the way for the spatialized reconfiguration of ... within a discourse of accumulation As images accumulate, our recognition of the movies they are taken from accumulates, and along with it, a recognition of our own cultural capital as cinema-literate...
- 10
- 612
- 0
Báo cáo khoa học: On the mechanism of a-amylase Acarbose and cyclodextrin inhibition of barley amylase isozymes pdf
... (e) The AMY1 concentration [E]0 was 38.8 lM decreasing to 37.3 lM by addition of acarbose A0 is the AMY1 absorbance without acarbose, A is the absorbance measured at the above acarbose concentrations ... dissociation constants In this equation, it was easier for a calculated constant to compare its value relative to zero rather than to obtain a large value When the association constant value was close ... Statistical analysis of the experimental initial rates (v) was performed using the general MichaelisMenten initial velocity equation for determination of kcat and Km and calculation of the catalytic...
- 9
- 437
- 0
Review of the Need for a Large- scale Test Facility for Research on the Effects of Extreme Winds on Structures pptx
... FEMA Federal Emergency Management Agency INEEL Idaho National Engineering and Environmental Laboratory NASA National Aeronautics and Space Administration NIST National Institute of Standards and ... Damage Investigation, and the U.S.-Japan Natural Disaster Task Committee on WindHazards He has served on the board of the American Association for Wind Engineering and is a member of the American ... the value of large-scale testing data (as compared to observational data) in the development and validation of computer simulations as a vehicle for (1) public education, (2) the validation of...
- 49
- 588
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25