prognosis based on stage of disease and age
Tài liệu Báo cáo khóa học: Further insights into the assembly of the yeast cytochrome bc1 complex based on analysis of single and double deletion mutants lacking supernumerary subunits and cytochrome b pdf
Ngày tải lên :
19/02/2014, 12:20
... analysis of DNA on agarose gels, restriction endonuclease analysis, ligation of DNA fragments, Ó FEBS 2004 1212 V Zara et al (Eur J Biochem 271) transformation of Escherichia coli and isolation of ... transmembrane helix of subunit and helices G and H1 of cytochrome b and between the N-terminus of subunit and helix a of cytochrome b The figure was constructed from the crystal structure of the yeast ... Immunodetection of the yeast mitochondrial proteins was carried out with monoclonal and polyclonal antibodies by chemiluminescence The stained polyacrylamide gels and the fluorographs containing...
- 10
- 517
- 0
Six sigma in service organizations a conceptual framework based on aspects of implementation and performance
Ngày tải lên :
11/09/2015, 09:11
... discussions regarding quality management The international and national competitive environment is in a process of constant change by the globalization of markets and the increased independence of ... development of conceptual frameworks, the empirical testing of these frameworks and the application of the tools and frameworks to improve service management (Johnston, 1999) The various stages of service ... discussion about the findings from surveys and case studies, and framework consolidation, finally in conclusion, implications, limitations, and future research are discussed An illustration of the...
- 343
- 315
- 0
Báo cáo y học: " Effects of disease modifying agents and dietary intervention on insulin resistance and dyslipidemia in inflammatory arthritis: a pilot study" pptx
Ngày tải lên :
09/08/2014, 06:22
... intervention Dietary recommendation consisted of calorie restriction to 1500 cal/day, carbohydrate restriction to 40% of total calorie intake, and replacement of saturated by monounsaturated and n-3 ... prednisone (20 mg/day and mg/day) Over the months following enrolment, those doses were decreased to 15 mg/day and mg/day At enrolment and during the third month after initiation of antirheumatic agents ... identification of decreased insulin sensitivity Materials and method Patients and investigations Twenty-two patients, 15 of whom met the American College of Rheumatology criteria for RA [13] and seven of...
- 7
- 365
- 0
Báo cáo khoa học: A new clan of CBM families based on bioinformatics of starch-binding domains from families CBM20 and CBM21 potx
Ngày tải lên :
07/03/2014, 21:20
... evolutionary tree This provides a basis for the joining of the two CBMs into a common clan Results and Discussion Location of SBD modules in CBM20 and CBM21 With regard to the location of the ... independently retains its function even when the target 5498 protein is not an amylase [44–48] On the other hand, there is a lack of information on structure–function relationships of the CBM21 module The ... CBM21 part of the tree and vice versa In the past, by far the most attention was paid to the evolution of Fig Alignment of SBD sequences from CBM20 and CBM21 families For an explanation of the colour...
- 17
- 476
- 0
Classification of colorectal cancer based on correlation of clinical, morphological and molecular features doc
Ngày tải lên :
22/03/2014, 17:20
... early evolution of CRC in Lynch syndrome Heterogeneity of sporadic MSS CRC: stratification based on DNA methylation and low-level MSI Removal of the two forms of MSI-H CRC (familial and sporadic) ... and CRC as described above Molecular alterations occurring at the key transition from hyperplasia to dysplasia include loss of expression of MLH1 in group CRC and loss of expression of MGMT and ... MSI-H144 but (and consistent with the rarity of medullary carcinoma) mutation of this gene was observed in only 3.2% of Lynch syndrome CRC.145 Loss of expression of CDX2 was strongly associated...
- 18
- 679
- 0
Báo cáo khoa học: "Information Classification and Navigation Based on 5W1H of the Target Information" doc
Ngày tải lên :
31/03/2014, 04:20
... classification and navigation W ~ W I H Classification and Navigation X~; Conventional keyword -based retrieval does not consider logical relationships between keywords For example, the condition, "NEC ... classification 96.10 NEC adjusts semiconductor production downward I 96.12 NEC postpones semiconductor production plant construction 97.1 97.4 NEC invests ¥ 40 billion for next generation semiconductor ... Multi-dimensional classification example (2) trieval and multi-dimensional classification because they only add unnecessary information and not remove necessary information The precision independent of...
- 7
- 637
- 0
Báo cáo hóa học: "Assessment of skeletal muscle fatigue of road maintenance workers based on heart rate monitoring and myotonometry" docx
Ngày tải lên :
20/06/2014, 00:20
... measurements Page of (page number not for citation purposes) Journal of Occupational Medicine and Toxicology 2006, 1:20 left hand right hand 500 R2 = 0,7665 Days 350 300 R2 = 0,3725 left hand right hand ... the parameters of some muscle groups in the contracted state and reflecting their state during work Page of (page number not for citation purposes) Journal of Occupational Medicine and Toxicology ... testing end of myometer; amax is the maximal amplitude of oscillation, and ∆l is the depth of the displacement of the testing end Measurements for determination of muscle tone during one week work...
- 9
- 371
- 0
Báo cáo hóa học: " Mapping background values of atmospheric nitrogen total depositions in Germany based on EMEP deposition modelling and the European Moss Survey 2005 Kartierung der Hintergrundwerte atmosphärischer Stickstoff-" docx
Ngày tải lên :
21/06/2014, 03:20
... Germany Conclusions The linking of modelled EMEP data on the atmospheric depositions of total N and the accumulation of N in mosses allows to map the deposition of total N in a high resolution of km ... Environmental Sciences Europe 2011, 23:18 http://www.enveurope.com/content/23/1/18 Page of on total N deposition in a resolution of km by km Recent updates of the modelled atmospheric deposition of ... Kombination mit Daten der N-Anreicherung in Moosen aus dem International Cooperative Programme on Effects of Air Pollution on Natural Vegetation and Crops (ICP Vegetation) der United Nations Economic...
- 9
- 425
- 0
Báo cáo hóa học: " Research Article Multimodality Inferring of Human Cognitive States Based on Integration of Neuro-Fuzzy Network and Information Fusion Techniques" pot
Ngày tải lên :
22/06/2014, 19:20
... corresponding to relaxation and creativity, and beta band (13–25 Hz) corresponding to activity and alertness [7, 8, 20, 39, 40] Note that among these bands only the theta and alpha bands have strong ... that work only considered the EEG signal Further in that work, the final aggregation of several channels of information sources into one state has not considered the contribution variation of individual ... as noises, and driving hours (DH); and (iii) environment conditions such as monotony of road (MR), and the number of lanes (NL) The inferring of fatigue based on these features is developed by...
- 14
- 303
- 0
Báo cáo hóa học: " Segmentation of DNA into Coding and Noncoding Regions Based on Recursive Entropic Segmentation and Stop-Codon Statistics" ppt
Ngày tải lên :
23/06/2014, 01:20
... composed of two randomly chosen regions from bacterium Rickettsia prowazekii The first region of 1016 bp belongs to a coding region and the second one of 1151 bp be- longs to a noncoding region Figure ... codons Stop codons in one phase Stop codons in two phases Stop codons in three phases Figure 1: Distribution of stop codons along three phases in noncoding DNA regions Figure 2: Distribution of ... DNA into Coding and Noncoding Regions 83 Table 1: Distribution of stop codons along phases for coding and noncoding DNA regions DNA sequence Sequence length [bp] No stop codons [%] one 40 40 80...
- 11
- 335
- 0
Báo cáo y học: "he combined effect of gender and age on post traumatic stress disorder: do men and women show differences in the lifespan distribution of the disorder" potx
Ngày tải lên :
09/08/2014, 01:21
... 16-20 years of age Age group 6: 36-40 years of age Age group 10: 56-60 years of age Age group 14: 76-80 years of age Age group 3: 21-25 years of age Age group 7: 41-45 years of age Age group 11: ... and the trauma sample, respectively Age group 1: 11-15 years of age Age group 5: 31-35 years of age Age group 9: 51-55 years of age Age group 13: 71-75 years of age Age group 2: 16-20 years of ... years of age Age group 4: 26-30 years of age Age group 8: 46-50 years of age Age group 12: 66-70 years of age Figure Lifespan distribution of post traumatic stress disorder (PTSD) based on Harvard...
- 12
- 507
- 0
Báo cáo khoa học: " Potentials of on-line repositioning based on implanted fiducial markers and electronic portal imaging in prostate cancer radiotherapy" docx
Ngày tải lên :
09/08/2014, 09:22
... comparison of the use of bony anatomy and internal markers for offline verification and an evaluation of http://www.ro-journal.com/content/4/1/13 41 42 43 44 the potential benefit of online and offline ... van Moorselaar RJ, Hofman P, Lagendijk JJ: Comparison of megavoltage position verification for prostate irradiation based on bony anatomy and implanted fiducials Radiother Oncol 2003, 68:81-8 ... to detect the position of the landmarks and markers in the LR and SI direction and the lateral beam for the AP direction and SI direction as well To identify the position of the target m, we...
- 9
- 300
- 0
Báo cáo y học: "Archaeal phylogeny based on proteins of the transcription and translation machineries: tackling the Methanopyrus kandleri paradox" pdf
Ngày tải lên :
09/08/2014, 20:21
... information The comparison of the percentages of amino-acid differences in transcription and translation fusion datasets for each pair of species is shown in Figure A strong correlation between ... the lack of TFS may prevent dissociation of stalled complexes and consequently increase the number of replication fork disruptions due to collision between the replication and transcription machineries ... sufficient taxonomic sampling and no evidence of multiple paralogies and/ or LGT were retained and concatenated into two large fusions, one consisting of 14 proteins of the transcription apparatus...
- 12
- 470
- 0
an analysis of clause expansion in two thanksgiving day gentlemen based on systemic functional grammar and suggestions for teaching writing = phân tích về cú mở rộng trong tác phẩm hai quý ông trong ngày lễ tạ ơn
Ngày tải lên :
02/03/2015, 14:25
... the notion of ‗rank‘ In other words, a sentence consists of one or more clauses; a clause consists of one or more groups; a group consists of one or more words; and a word consists of one or more ... condition, purpose, cause, concession… The division of Elaboration into three smaller types (Exposition, Exemplification, and Clarification) and Extension into two subtypes (Addition and Variation) ... TABLE OF CONTENTS Page Acknowledgement i Table of Contents ii Chapter I: INTRODUCTION 1.1 Rationale of the study 1.2 Aims of the study 1.3 Scope of the study 1.4 Methods of the study 1.5 Design of...
- 61
- 820
- 0
An Analysis of the Philippines’ Marine Fishery Management based on the PSIR Framework and Implications for Vietnam
Ngày tải lên :
26/03/2015, 08:42
... allocated and enables us to understand and evaluate the impacts of economic activities on the ecosystem The determination of optimal allocation of resources calls for understanding of both economic ... ecosystem can only smoothly and properly function if it consists of a wide variety of species, of different sizes and ages (FAO, 2011; Green, White, Flores, Carrecon, and Sia, 2003) Among the above ... the environmental, socio and economic impacts of overexploitation of marine fishery resources requires an efficient management of this resource, in which ecological and economic aspects of the...
- 14
- 237
- 0
Constructal complex objective optimization of electromagnets based on maximization of magnetic induction and minimization of entransy dissipation rate
Ngày tải lên :
09/09/2015, 10:06
... performance of electromagnet requests high magnetic induction and low temperature A complex-objective function based on maximization of magnetic induction and minimization of entransy dissipation rate ... optimization results of Ref [66] were obtained with fixed magnetic induction Complex-objective function of minimization of entransy dissipation rate and maximization of magnetic induction For the ... reconsideration in the constructal design of cavities Energy Conversion and Management, 2013, 66: 33–40 [32] Hajmohammadi M R, Campo A, Nourazar S S, Ostad A M Improvement of forced convection...
- 12
- 225
- 0
Efficient retrieval and categorization for 3d models based on bag of words approach
Ngày tải lên :
10/09/2015, 09:10
... Illustration of DSURF feature representation based on Haar wavelet responses of a sub-region centered at the interest point. 70 Figure 5.3 Integral images makes the computation of summation of ... from thousands of features extracted As we will detail the feature extraction stages in chapter and chapter In this section, we only put focus on the codebook generation and representation of 3D ... Class of Comparison Similar Models Bag -of- words Model Representation Figure 3.1 Overview of Retrieval and Categorization of 3D Models based on Bag -of- words Representation As bag -of- words model...
- 126
- 319
- 0
Therapeutic target analysis and discovery based on genetic, structural, physicochemical and system profiles of successful targets
Ngày tải lên :
11/09/2015, 09:57
... description of these three loss -of- function target validation tools mentioned above, and illustrates their corresponding advantages and limitations None of these three loss -of- function technologies ... the study of protein functional profiles In conclusion, commonly used computational methods for druggable protein prediction are generally based on the detection of sequence and functional similarity ... predisposition and environmental causes37-42 With the rapid accumulation of biological data and increasing understanding of disease mechanisms, the target validation process, however, has become more and...
- 248
- 201
- 0
analysis of segregation in cross between wild soybean (glycine soja) and cultivated soybean (glycine max) based on morphology, agronomic traits and ssr marker
Ngày tải lên :
06/10/2015, 13:05
... http://www.soybase.org/ 20 Conclusions and suggestions 4.1 Conclusions Pod colors were tan, black, and brown The segregation of pod color fitted to (1 : : 1) ratio The segregation of hilum color fitted ... GGCCAGATACCCAAGTTGTACTTGT LG: linkage group Source: http://www.soybase.org/ The components of each reaction and the PCR cycle was shown in Table and Figure Table The reaction components of PCR Components Buffer ... Heritability of agronomic characters 10 3.4 Inheritance of growing characters 11 3.5 Genotypic inheritance 14 ii Conclusions and suggestions 21 4.1 Conclusions 21 4.2 Suggestions...
- 28
- 247
- 0