principle 1 base your management decisions on a long term philosophy even at the expense of short term financial goals
Study of technical feasibility and the payback period of the invested capital for the installation of a grid connected photovoltaic system at the library of the technological federal university of paraná
... period of photovoltaic generation (R$/kWh) The equations 6, and show the calculation of the monthly financial return, while the Equations 9, 10 and 11 shows the calculation of the annual financial ... Fusano [17 ] has found a difference of 5,5% between annual average daily irradiation obtained at the weather station INMET and database SWERA To conclude, this paper considered 5,5% of the annual average ... Federal University of Santa Catarina Situated at the Solar Energy Laboratory – LABSOLAR, at the UFSC (Federal University of Santa Catarina), there is the first Grid-connected Photovoltaic System of...
- 12
- 431
- 0
A STUDY ON THE USE OF PEER TEACHING IN ESP CLASSES AT THE COLLEGE OF SCIENCE, VIETNAM NATIONAL UNIVERSITY HANOI
... data interpretation As the research’s aim is to examine the impact of ‘Peer-teaching’ on ESP teaching and learning quality, the collected data of the study was analyzed both quantitatively and ... teaching in which all decisions as to content and method are based on the learner’s reason for learning” (Hutchinson and Waters, 19 87: 19 ) Likewise, Strevens (19 88: 1) stated that “ESP is a particular ... would have the following features: • It is purposeful and aimed at the successful performance of occupational or educational roles by an individual or a group • It is based on an analysis of the...
- 40
- 903
- 3
Tài liệu Pension Fund Indicators 2012 A long-term perspective on pension fund investment docx
... 19 86 19 87 19 88 51 53 54 52 14 16 13 16 17 14 14 12 3 3 1 1 11 10 10 19 89 19 90 19 91 1992 52 52 55 56 20 18 20 21 8 3 3 2 3 4 10 19 93 19 94 19 95 19 96 57 54 55 53 24 23 22 22 6 5 3 4 5 5 19 97 19 98 19 99 ... 19 75 19 76 48 34 45 44 4 5 26 27 26 28 16 14 19 15 16 19 77 19 78 19 79 19 80 45 45 45 46 5 28 28 26 25 6 17 16 17 17 19 81 1982 19 83 19 84 45 44 45 49 10 12 15 14 21 22 20 17 3 4 4 18 15 13 12 19 85 19 86 ... like the unpredictable nature of the weather, when markets not behave like they are meant to, what happens then? Surely the return differential between the cash rate and inflation is relatively...
- 12
- 359
- 0
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc
... GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU T46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3¢); GLU H44 7A, D45 0A ... (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), GLU H44 7A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA ... et al Glucoamylase raw starch binding site reverse (5¢-GTTCATTCAAGGAGCCATCAGCATTAAT AGCATCCAAAATGACTTGC-3¢) All mutations were verified by DNA sequencing Glucoamylase Glu Enzyme preparation and...
- 11
- 548
- 0
Hollywood on the Head of a Pin: Montage and Marketing at the Oscars® docx
... throughout the montage is the fact that they place the individual clips within a discourse of accumulation As images accumulate, our recognition of the movies they are taken from accumulates, and along ... showcases—are for a variety of products, their metonymic linkage to the film history montage overdetermines the montage’s celebration of spectatorship as accumulation and consumption Accumulation ... “MediaSpace” of advocacy marketing (the hallowed hall of the Academy Awards telecast venue itself) with a naturalization of cinema as performance a move moreover appropriate to marketing a commodity...
- 10
- 612
- 0
Báo cáo toán học: "A calmodulin inhibitor, W-7 influences the effect of cyclic adenosine 3'''', 5''''-monophosphate signaling on ligninolytic enzyme gene expression in Phanerochaete chrysosporium" pot
... Japan) were performed as follows: (i) an initial denaturation step at 95°C for 10 s and (ii) 40 cycles, with each cycle consisting of denaturation at 95°C for s and annealing and elongation at ... coefficient of veratryl aldehyde (oxidized veratryl alcohol) at 310 nm is 9,300 M-1cm -1 One unit of enzyme activity represents the oxidation of veratryl alcohol to veratryl aldehyde at a rate of µM/min ... Yao1, Yoshifumi Hida1, Yoichi Honda2, Takashi Watanabe2, Wataru Hashigaya1, Kazumi Suzuki1, Toshikazu Irie1,† Environmental Science Graduate School, The University of Shiga Prefecture, 2500 Hassaka-cho,...
- 34
- 397
- 0
báo cáo hóa học:" A calmodulin inhibitor, W-7 influences the effect of cyclic adenosine 3’, 5’-monophosphate signaling on ligninolytic enzyme gene expression in Phanerochaete chrysosporium" pot
... Japan) were performed as follows: (i) an initial denaturation step at 95°C for 10 s and (ii) 40 cycles, with each cycle consisting of denaturation at 95°C for s and annealing and elongation at ... quantitation b a a a a a a a a LiP activity (U/L) 10 0 Control cAMP+IBMX W-7+cAMP+IBMX b b 50 b b a a a a c a c c Gene name (Figure 3) In the case of addition of only W-7, the result was same as in the ... cAMP concentration (Figure 5) All these data suggest that cAMP Sakamoto et al AMB Express 2 012 , 2:7 http://www.amb-express.com/content/2 /1/ 7 Page of b b b a c b a b a b c b a a a aa b a c a a...
- 9
- 398
- 0
Báo cáo hóa học: "A calmodulin inhibitor, W-7 influences the effect of cyclic adenosine 3’, 5’-monophosphate signaling on ligninolytic enzyme gene expression in Phanerochaete chrysosporium" pptx
... Japan) were performed as follows: (i) an initial denaturation step at 95°C for 10 s and (ii) 40 cycles, with each cycle consisting of denaturation at 95°C for s and annealing and elongation at ... quantitation b a a a a a a a a LiP activity (U/L) 10 0 Control cAMP+IBMX W-7+cAMP+IBMX b b 50 b b a a a a c a c c Gene name (Figure 3) In the case of addition of only W-7, the result was same as in the ... cAMP concentration (Figure 5) All these data suggest that cAMP Sakamoto et al AMB Express 2 012 , 2:7 http://www.amb-express.com/content/2 /1/ 7 Page of b b b a c b a b a b c b a a a aa b a c a a...
- 9
- 438
- 0
cáo khoa học: " Developing a theory-based instrument to assess the impact of continuing professional development activities on clinical practice: a study protocol" doc
... Epidemiology Program, Ottawa Hospital Research Institute, Ottawa, Canada 11 Faculty of Nursing, Université Laval, Québec, Canada 10 11 12 13 14 15 16 17 18 19 20 21 22 Authors’ contributions All authors ... 23 24 Federation of Medical Regulatory authorities of Canada: Position statement 2008 of the Federation of Medical Regulatory Authorities of Canada Graham ID, Logan J, Harrison MB, Straus SE, Tetroe ... University, Montréal, QC, Canada FL is Canada Research Chair in Implementation of Shared Decision Making in Primary Healthcare GG is Canada Research Chair in Health Behaviours and Canada Research Chair...
- 6
- 501
- 0
Báo cáo y học: " Trans-inhibition of HIV-1 by a long hairpin RNA expressed within the viral genome" pps
... LAI LAI-lhNef AS44 AS15 HIV HIV-lhNef AS44 AS19 AS15AS19 AS 11 HIV HIV- AS44 AS19 AS15 AS 11 lhNef AS 11 AS6 AS6 AS6 R1 B trans-inhibition of HIV -1 CA-p24/RL (%) 360 360 300 300 240 240 18 0 18 0 12 0 ... AS19 M - HIV 10 00 - - AS19 800 B 12 16 19 23 35 58 days HIV + AS19 M 10 :1 1 :1 1 :10 - HIV - AS19 10 00 800 600 - C M 10 00 800 - HIV R1 AS19 12 16 19 23 12 16 19 23 12 16 19 23 days HIV + R1 AS19 ... 25 30 days after transfection HIV AS44 AS6 HIV-lhNef AS19 AS15 AS 11 Figure Virus replication of HIV-lhNef and the escape variants in PBMC Virus replication of HIV-lhNef and the escape variants...
- 14
- 348
- 0
Normal adrenocortical function on initial testing in the intensive care unit: not a long-term warranty pdf
... G: On the term “relative adrenal insufficiency” - or what we really measure with adrenal stimulation tests? J Clin Endocrinol Metab 2005, 90:4973-4974 Arafah BM: Hypothalamic pituitary adrenal ... normal adrenocortical function later developed absolute adrenocortical insufficiency according to conservative criteria [12 ] Importantly, the patients had received no etomidate or ketoconazole ... clinical practice? While awaiting further studies, we should agree with the keymessage of Wu and colleagues: normal initial adrenocortical function is not a warranty for the ICU stay and repeated...
- 2
- 212
- 0
Blood on FTA™ Paper: Does Punch Location Affect the Quality of a Forensic DNA Profile?
... prevent any further degradation In the case of database samples, a physical sample of the offender’s DNA must be kept in the laboratory indefinitely in case a database hit ever occurs and the ... location reactions failed and 8% of the halfway punch location reactions failed The halfway punch location showed the highest percentage of failed reactions The success rates of each punch location ... data The dark square represents the location of the average peak height ratio for each punch location 31 Figure 11 An example of peak height imbalance at the center punch location...
- 169
- 383
- 0
A study on the difficulties in learning speaking English of the first year students at the Faculty of Information Technology, Thai Nguyen University
... translated into Vietnamese, and the interviews were carried out in Vietnamese in informal situations in the break or in the yard 2.5 Data analysis Data gathered from the responses of the teachers ... levels Class size The debate on class size has taken for a long time There have been many different ideas about that The old researches claimed that class size has great impact on the student‟s achievement ... FIT Further more, data could also be obtained through the class observation or attendant in class for further reliability To make the data collected reliable and accurate, all the questionnaires...
- 63
- 5,863
- 13
A study on an example of non-verbal interaction between the presenter and audience for English majored students at the School of Foreign Language
... messages as well as main ideas In the conclusion, they act out a drama or let their audience play a game that summary the main ideas of the presentation On the contrary, in the table, we can see ... true And 25% sometimes that The majority of the students are aware of the fact that if all information of the presentation appeared in the slides that means they misuse their slides instead of ... The chapter starts with research questions, clear description of subject, data collection instrument, data gathering procedures, data analysis At the end of this chapter is a conclusion 2 .1 Paticipants...
- 50
- 454
- 2
a study on the impact of the communicative approach to grammar teaching on students interest at the institute of foreign language hanoi university of agriculture
... sentence pattern as the base of teaching and tries to avoid mother tongue as in class Attention is paid to the need for mechanical practice rather than explanation about the language because the ability ... knowledge of the target language to pass national examinations which still focus on grammar In addition, most learners and teachers agree that mastering the grammar of a language may form an important ... the limitations of Grammar Translation method (form-based) and Communicative Approach (meaning –based), Pavel V Sysoyev (19 99) argued for a combination of formbased and meaning-based focus, and...
- 65
- 683
- 2
Knowledge Management A Theoretical Framework And Implementation At The “Big Four”
... notes that: “(organizations)…are gradually becoming aware that knowledge cannot be treated as an 19 organizational asset without the active and voluntary participation of the communities that are ... organizational processes that seek balance combination of data and information processing capacity of information technologies, the environment of using and sharing information and knowledge and ... with the letter C: • Contextualize: Why is the data gathered? • Categorize: Define the units of analysis • Calculate: Mathematically or statistically analyze the data • Correct: Errors are removed...
- 54
- 423
- 0
TEACHING PRONUNCIATION TO THE FIRST YEAR STUDENTS AT THE UNIVERSITY OF TRANSPORT AND COMMUNICATIONS a CASE STUDY
... attainment of accurate pronunciation in a second language is a matter substantially beyond the control of educators’ They qualified their findings by stating that variables of formal training and ... in the pronunciation of English if the pronunciation class is taken out of isolation and becomes an 'integral part of the oral communication' class (Morley ,19 91) The goal of pronunciation should ... students pronunciation (Suter 19 76, Purcell and Suter, 19 80) In other words, the attainment of accurate pronunciation in a second language is a matter of substantially beyond the control of educators...
- 40
- 984
- 4
Tài liệu CUSTOMER THINK GUIDE TO REAL CRM PUTTING CUSTOMERS AT THE HEART OF YOUR BUSINESS PROFITABLY. ppt
... CustomerThink Corporation C u sto m erT h in k G u id e t o R ea l C R M 20 OLAP database Short for “online analytical processing database.” A relational database system capable of handling queries ... issue and cements a solid relationship association to the corporate entity WORKFLOW AUTOMATION AND INTERACTION MANAGEMENT Workflow is the linkage both within each set of organizational functions as ... important in the creation of lasting customer relationships Sadly, the view of value creation or value addition — “value added” has become one of the most popular marketing claims of Functional value,...
- 23
- 603
- 0
Tìm thêm: khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25