prevention of hepatitis c infection in egypt
báo cáo khoa học: " The effectiveness of behavioural interventions in the primary prevention of Hepatitis C amongst injecting drug users: a randomised controlled trial and lessons learned" pot
Ngày tải lên :
11/08/2014, 18:20
... for contracting hepatitis C. Stratification was
achieved in blocks of six within each variable, such that in
each block of six half of the clients would receive SEC and
half of the clients EPC. ... infection in injecting drug users. HCV
transmission risk behaviours include injecting drugs, the
sharing of injecting equipment, not cleaning and reusing
drug paraphernalia, alcohol misuse, cocaine ... take place
through changes in outcome expectancies (expected con-
sequences of a course of action, e.g. sharing injecting
equipment) and self efficacy (confidence in one's ability
to achieve...
- 12
- 454
- 0
Báo cáo y học: "Serological and molecular expression of Hepatitis B infection in patients with chronic Hepatitis C from Tunisia, North Africa" pdf
Ngày tải lên :
12/08/2014, 01:21
... Demographical characteristics and HCV genotype of HCV positive patients according to their HBV status
HBV (-) Resolutive HBV infection Ongoing HBV infection Ongoing HBV infection
Overt HBV infection Occult ... Sagnelli E, Coppola N, Marrocco C, Onofrio M, Sagnelli C, Coviello G,
Scolastico C, Filippini P: Hepatitis C virus superinfection in hepatitis B
virus chronic carriers: a reciprocal viral interaction ... E, Coppola N, Scolastico C, Filippini P, Santantonio T, Stroffolini T,
Piccinino F: Virologic and clinical expressions of reciprocal inhibitory
effect of hepatitis B, C, and delta viruses in...
- 6
- 516
- 0
Báo cáo sinh học: " Evolution of naturally occurring 5''''non-coding region variants of Hepatitis C virus in human populations of the South American region" doc
Ngày tải lên :
18/06/2014, 18:20
...
TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTACAGCCTCCAGGACCCCCCCTCCCGGGAGA
GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG
GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG
CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT ... 150
ʜʜ
cgucua
gccauggcguuaguaugagugucgugcagccuccaggaccccccccucccgggagagccauaguggucu
domain II
gu a g u u c
200
ʜ
gcggaaccggugaguacac
cggaauuccaggcagaccgguccuuucuuggaucaacccgcucaaugccuggagauu
domain IIIa domain IIIb ... Gaps introduced during alignment are
indicated by a dot.
A
63
TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGA
TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTACAGCCTCCAGGACCCCCCCTCCCGGGAGA...
- 12
- 354
- 0
Báo cáo y học: " Virological pattern of hepatitis B infection in an HIV-positive man with fatal fulminant hepatitis B: a case report" doc
Ngày tải lên :
11/08/2014, 17:21
... dis-
ease in chronic HBsAg carriers.
We investigated the hepatic and extrahepatic patterns of
HBV infection in a patient who was also infected with HIV
and who was participating in a prospective ... Morsica* - morsica.giulia@hsr.it
* Corresponding author
Abstract
Introduction: There seem to be no published data concerning the clinical impact of populations
of hepatitis B virus (HBV) in the ... not for citation purposes)
Journal of Medical Case Reports
Open Access
Case report
Virological pattern of hepatitis B infection in an HIV-positive man
with fatal fulminant hepatitis B: a case report
Sabrina...
- 7
- 348
- 0
Báo cáo y học: "Role of anti-cyclic citrullinated peptide antibodies in discriminating patients with rheumatoid arthritis from patients with chronic hepatitis C infection-associated polyarticular involvement" potx
Ngày tải lên :
09/08/2014, 01:23
... patients
with chronic hepatitis C infection- associated polyarticular
involvement
Michele Bombardieri*, Cristiano Alessandri*, Giancarlo Labbadia, Cristina Iannuccelli,
Francesco Carlucci, Valeria Riccieri, ... chronic HCV infection and associated
articular involvement and 31 patients with chronic HCV
infection without any joint involvement. In addition, we
retrospectively analysed sera collected at ... presence of extrahepatic manifestations is a relatively
common feature in patients with chronic hepatitis C virus
(HCV) infection [1,2]. Among the different clinical disor-
ders associated with HCV infection, ...
- 5
- 312
- 0
Báo cáo y học: "Sustained eradication of hepatitis C virus by low-dose long-term interferon therapy in a renal transplant recipient with dual infection with hepatitis B and C viruses: a case report" pptx
Ngày tải lên :
10/08/2014, 23:21
... long-term interferon therapy could achieve
sustained eradication of HCV infection in renal trans-
plant recipients with dual HBV and HCV infections.
Consent
Written informed consent was obtained from ... interferon therapy in a renal
transplant recipient with dual infection with
hepatitis B and C viruses: a case report
Ming-Ling Chang
1
, Ping-Chin Lai
2
and Chau-Ting Yeh
3*
Abstract
Introduction: ... mortality in renal transplant recipients [2]. Besides
accelerated deterioration of liver function in chronic
HCV infection, HCV-related glomerulopathy [3] and
HCV-associated fibrosing cholestatic hepatitis...
- 4
- 282
- 0
Báo cáo y học: "Epidemiology of Hepatitis C Virus (HCV) Infection"
Ngày tải lên :
02/11/2012, 09:56
... physician should also offer
counseling on treatment, reducing alcohol usage and
immunization with hepatitis A, hepatitis B,
pneumococcal and influenza vaccines. HCV negative
persons with ongoing ... be elucidated.
Conflict of interest
The authors have declared that no conflict of interest
exists.
References
1. WHO. Global surveillance and control of hepatitis C. Report of a
WHO Consultation ... Bacchus R,
Ring C, Garson J. Hepatitis C virus in Egyptian blood donors in
Riyadh. Lancet 1991; 33: 359-60.
18. Darwish NM, et al. Hepatitis C virus infection in blood donors in
Egypt. J Egypt...
- 6
- 486
- 0
Báo cáo y học: "The Natural History of Hepatitis C Virus (HCV) Infection"
Ngày tải lên :
02/11/2012, 09:56
... Factors for Developing Chronic HCV Infection
Risk Factors
Age at time of infection > 25 years
Male gender
No jaundice or symptoms during acute infection
African American race
HIV infection ... develops. The
rate of chronic HCV infection is affected by many factors,
including the age at time of infection, gender, ethnicity,
and the development of jaundice during the acute
infection (see ... 180,000 cases per year in the mid-1980s
(peak incidence), but declined to approximately 30,000
new cases per year in 1995.[13] The incidence of acute
hepatitis C infection in the U.S. declined...
- 6
- 530
- 0
Báo cáo y học: "Epidemiology and Prevention of Hepatitis B Virus Infection"
Ngày tải lên :
02/11/2012, 11:12
...
Characteristic Endemicity of infection
Low (%) Intermediate (%) High (%)
Chronic infection prevalence 0.5-2 2-7
≥8
Past infection prevalence 5-7 10-60 70-95
Perinatal infection Rare Uncommon ... the infant and adolescent vaccinatin programmes in Italy. Vaccine 2000;18:S31-S34.
77. Chang MH, Chen CJ,cLai MS. Universal hepatitis B vaccination in Taiwan and the incidence of hepatocellular ... the efficacy of hepatitis B vaccination. The incidence of HCC dropped from 3.27/10,000 to 0.17/10,000, a 94.8% decrease,
in the group of 0-19 year-olds. The average incidence of HCC in general...
- 8
- 643
- 0
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx
Ngày tải lên :
20/02/2014, 01:20
... Paris,
France). The primers used were VB1: 5Â-AAACATATGA
GCATGAGCTACCACCTGGACC-3Â and VB3: 5Â-CTCG
AGCTTCACAAGAAACTTCTGC-3Â. The PCR fragment
was cleaved by the restriction enzymes Nde1 and Xho1 and
inserted ... of a chimeric
cDNA clone of hepatitis C virus genotype 1b are infec-
tious in vivo. Virology 244, 161–172.
22 Mottola G, Cardinali G, Ceccacci A, Trozzi C,
Bartholomew L, Torrisi MR, Pedrazzini ... amount
of radioactivity incorporated into the nucleic acids was measured
after TCA precipitation and plotted against the incubation time in
minutes.
T. Astier-Gin et al. Binding and replication of...
- 15
- 597
- 0
Báo cáo khoa học: Recent contributions of in vitro models to our understanding of hepatitis C virus life cycle pdf
Ngày tải lên :
16/03/2014, 05:20
... defences
antiviral screening
few cell lines support infection
technical difficulties of primary cell culture
HCV-LP Infection, morphogenesis cell attachment
vaccination
morphogenesis
no secretion of ... during the culture of infected
hepatocytes. To succeed in obtaining HCV infection in
primary human hepatocytes, an existing model of hep-
atitis B virus infection was used to determine optimal
infection ... liver diseases includ-
ing acute and chronic hepatitis, cirrhosis and hepatocellular carcinoma. Its
high prevalence, the absence of a prophylactic vaccine and the poor effi-
ciency of current therapies...
- 14
- 532
- 0
Báo cáo khoa hoc:" Refractoriness of hepatitis C virus internal ribosome entry site to processing by Dicer in vivo" ppt
Ngày tải lên :
11/08/2014, 07:21
... using forward (5'-gcgcgcggatccgccagccccct-
gatgggggcgacac-3') and reverse (5'-gcgcgcggatccaggttgcgac-
cgctcggaagtcttcc-3') oligonucleotides, and cloned in the
BamHI site of ... was conceived by
cloning in psiSTRIKE the pre-mmu-miR-328 sequence
(5'accgtggagtgggggggcaggaggggctcagggagaaagtgcatacagccc
ctggccctctctgcccttccgtcccctgt ttttc-3') (Promega). The
Rluc:miR-328 ... or 3 copies of
the PC (5'-atctcaacggaagggcagagagggccagatctc-3') or WT
(5'-atctcgtccctgtggtaccctggcagagaaagggccaatctcaatctc-3')
binding sites into the PmeI site of psiCHECK (Promega).
The...
- 13
- 362
- 0
báo cáo khoa học: "Identification of improved IL28B SNPs and haplotypes for prediction of drug response in treatment of hepatitis C using massively parallel sequencing in a cross-sectional European cohor" pot
Ngày tải lên :
11/08/2014, 12:21
... care.
The predictive value of SNPs is best calculated from rou-
tine clinical practice, rather than the clinical trial sce-
nario, since these are the conditions in which most
patients are treated ... haplotypes are indicated in blue. Screenshot taken from UCSC draft human genome [28].
Table 1 Demographic characteristics of chronic hepatitis C patients after therapy
Demographic factors
a
Gender
Mean ... vitamin D
3
,
and HLA -C genotype. From genotyping, SNP rs48 03221
and HLA -C C 2C2 provides the best predictive value.
Clinical utility
Therapy for HCV infection is currently undergoing a
radical...
- 13
- 401
- 0
Báo cáo y học: " Mutations in the E2-PePHD region of hepatitis C virus genotype-3a and correlation with response to interferon and ribavirin combination therapy in Pakistani patients" pptx
Ngày tải lên :
11/08/2014, 21:21
... resulted in replacement of hydrophilic and basic
amino acids with a neutral amino acid in rapid respon-
ders and replacement of a neut ral amino acid with
hydrophilic and basic amino acid in b reakthrough
responders. ... are carriers for HCV [2].
In 60-80% cases HCV may lead to hepatocellular carci-
noma (HCC) [3]. It comprises of 9600 nucleotides that
predetermines a polypeptide containing 3010-3033
amino acids ... N:
Predictors of the efficacy of interferon therapy in chronic hepatitis C
virus infection. Tokyo-Chiba Hepatitis Research Group 1997, 113:558-66.
9. Kaufman RJ: The Double-stranded RNA-activated...
- 5
- 254
- 0