preserved cd4 central memory t cells and survival in vaccinated siv challenged monkeys 1530

Báo cáo y học: "The relationship between CD4+CD25+CD127regulatory T cells and inflammatory response and outcome during shock states" potx

Báo cáo y học: "The relationship between CD4+CD25+CD127regulatory T cells and inflammatory response and outcome during shock states" potx

Ngày tải lên : 13/08/2014, 20:21
... severity and cytokines plasma concentrations Considering the correlation between Tregs and outcome, at least in septic patients, we evaluated the relation between these cells and severity Indeed, there ... different between patients and healthy volunteers throughout the study period, patients with shock presented with constantly decreased NK absolute To get further insight in to the role of Tregs during ... percentage of Tregs was higher in the septic patients than in the nonseptic patients and healthy volunteers, there were no differences in terms of absolute count, reflecting the persistence of the CD4+ ...
  • 11
  • 281
  • 0
Alloreactive t cells and cytokines in murine graft versus host disease 5

Alloreactive t cells and cytokines in murine graft versus host disease 5

Ngày tải lên : 16/09/2015, 17:13
... Limiting dilution analysis for alloreactive, TCGFsecretory T cells: two related LDA methods that discriminate between unstimulated precursor T cells and in vivo-alloactivated T cells Transplantation ... 1987 Diphtheria toxin receptor binding domain substitution with interleukin2: genetic construction and properties of a diphtheria toxin-related interleukin-2 fusion protein Protein Eng.1: 493 Williamson ... Rubin-Kelley V, Strom TB, Murphy JR 1991 Interleukin receptor targeted cytotoxicity: Genetic construction and in vivo immunosuppressive activity of a diphtheria toxin-related murine interleukin...
  • 33
  • 180
  • 0
Alloreactive t cells and cytokines in murine graft versus host disease 4

Alloreactive t cells and cytokines in murine graft versus host disease 4

Ngày tải lên : 16/09/2015, 17:13
... damages to these organs Our study found that the distinctive pattern of chemokines expressed in target/nontarget organs correlate with the infiltration kinetics of the donor T cells into these ... CD8+ T cells These observations indicate that other chemokines other than MIP-1α play a critical role in the recruitment of CD4+ T cells into the target organs It was recently reported that CXCR3 ... may contribute to the preferential recruitment of inflammatory cells into the liver and skin, but not into the heart, in acute GVHD The predominantly expressed chemokines MIP1α and Mig in the spleen,...
  • 26
  • 246
  • 0
Alloreactive t cells and cytokines in murine graft versus host disease 3

Alloreactive t cells and cytokines in murine graft versus host disease 3

Ngày tải lên : 16/09/2015, 17:13
... Results population on day post injection showed the proliferation of the injected cells in the control group but not the second batch of cells injected into the experimental group, indicating that ... recipient mice injected with these cells (data not shown) It was reported that one of the approaches that Treg cells exert their suppressive activity on normal T cells in MLC is by inhibiting the ... population and is not able to indicate the absolute infiltrating cell numbers, we examined the infiltrating T cells in these organs by immunohistology on tissue sections T cells were visualized with...
  • 62
  • 145
  • 0
Alloreactive t cells and cytokines in murine graft versus host disease 2

Alloreactive t cells and cytokines in murine graft versus host disease 2

Ngày tải lên : 16/09/2015, 17:13
... ATCCATCTGGCTAGGTCAGG–3’ Forward 5’- CAACGCTATCGCGTCGGATC–3’ Reverse 5’- TCGCTACTTAGCTACTCGAT–3’ Forward 5’- GCTAGGTCATCGGTCATCGG–3’ Reverse 5’- ACCAATGTCGATTAGCTACC–3’ Forward 5’- TTAAATCGTTGCGACAACTA–3’ ... AACCTTTAGTACCCATGCCA–3’ Reverse 5’- CACCTGTAGCTAGCTGCTAG–3’ Forward 5’- TAGCTGTCAACTCGATCTCC–3’ Reverse 5’- GGTCCTATTACGGCTACTAC–3’ Forward 5’-GTGGGCCGCTCTAGGCAC-3’ Reverse 5’-CTTTGATGTCACGCACGATTTC-3’ ... AAGATTCGFATCGATCGAGT–3’ Forward 5’- CGACAGATACGATCGATCAA–3’ Reverse 5’- AAGCATATCCTATCGATGAT–3’ Forward 5’- TAGCTTCTGATCGATGCATG–3’ Reverse 5’- TCTCATGCTAATCGATCGAT–3’ Forward 5’- TACTGCTACTGATCGACTGC–3’...
  • 24
  • 258
  • 0
Alloreactive t cells and cytokines in murine graft versus host disease 1

Alloreactive t cells and cytokines in murine graft versus host disease 1

Ngày tải lên : 16/09/2015, 17:13
... competent cells in the graft, the host appearing “foreign” to the graft, and the inability of the host to react sufficiently against the graft The interaction of donor cells and host target tissues ... Diphtheria toxin 1.5.4.1 Native toxin Diphtheria toxin (DT) was the first investigated toxin DT is a 58,348 kDa protein consisting of 535 amino acids (Smith et al., 1980), containing cysteine ... Chemokines play important roles in recruitment of activated or memory lymphocytes to sites of inflammation or tertiary lymphoid tissues by controlling the activity of integrins and inducing chemotaxis...
  • 45
  • 159
  • 0
Báo cáo y học: "Heterogeneity of CD4+ and CD8+ memory T cells in localized and generalized Wegener’s granulomatosis." potx

Báo cáo y học: "Heterogeneity of CD4+ and CD8+ memory T cells in localized and generalized Wegener’s granulomatosis." potx

Ngày tải lên : 09/08/2014, 01:21
... on CD4+ CD45RO+ and CD8 +CD45 RO+ and also on CD4+ CD45RA+ and CD8 +CD45 RA+ T cells indicates activation and the potential to respond to chemotactic gradients in inflammatory areas, which is consistent ... functional aspects such as response in vitro to chemotactic gradients, cytokine release and cytotoxic activity of distinct T cell populations Detection of the inducible inflammatory chemokine ... CD62L might constitute part of the CD45 RA+ ‘revertant’ memory T cell fraction We have previously shown that cytokine production is upregulated in patients with active disease and ineffective therapy...
  • 7
  • 354
  • 0
Báo cáo y học: "Decreased effector memory CD45RA+CD62L– CD8+ T cells and increased central memory CD45RA–CD62L+ CD8+ T cells in peripheral blood of rheumatoid arthritis patients" ppt

Báo cáo y học: "Decreased effector memory CD45RA+CD62L– CD8+ T cells and increased central memory CD45RA–CD62L+ CD8+ T cells in peripheral blood of rheumatoid arthritis patients" ppt

Ngày tải lên : 09/08/2014, 01:21
... patients are unknown Determination of these phenotypes in RA may provide important insights into T- cell homeostasis, and we therefore examined the distribution of CD4+ and CD8+ T cells into these ... skewed in patients with RA and results in an increase in central memory CD45 RA–CD62L+ CD8+ T cells, with a concomitant decrease in terminally differentiated effector memory CD45 RA+CD62L– CD8+ T cells ... Mann–Whitney U test and Student’s t- test for panel b and linear regression for panel d R94 Available online http://arthritis-research.com/content/5/2/R91 individuals and in SLE patients, indicating that...
  • 6
  • 323
  • 0
Báo cáo y học: "Phenotypic and functional characterisation of CD4+ memory T cells homing to the joints in juvenile idiopathic arthritis" pps

Báo cáo y học: "Phenotypic and functional characterisation of CD4+ memory T cells homing to the joints in juvenile idiopathic arthritis" pps

Ngày tải lên : 09/08/2014, 06:22
... role of CCR7 in the recruitment of CD4+ memory T cells into the inflamed joints of patients with JIA, and attempted the functional and anatomical dissection of these cells according to their expression ... follicular structures In contrast, CCR5+ cells were detected mainly in the lining layer and in the sublining zone of the superficial subintima and, to a smaller extent, in the perivascular infiltrates ... percentage positive cells or as mean fluorescence intensity; that is, the staining intensity of a test mAb minus that of an isotypematched, irrelevant control mAb The threshold for calculating the...
  • 12
  • 359
  • 0
Báo cáo y học: " Differential susceptibility of naïve, central memory and effector memory T cells to dendritic cell-mediated HIV-1 transmission" ppsx

Báo cáo y học: " Differential susceptibility of naïve, central memory and effector memory T cells to dendritic cell-mediated HIV-1 transmission" ppsx

Ngày tải lên : 13/08/2014, 09:20
... important role in HIV-1 pathogenesis, and TN, TCM and TEM cells have distinct functions and locations in the body, we set out to investigate the contribution of DC in infection of these T cell ... significant Competing interests The author(s) declare that they have no competing interests Authors' contributions FG designed the study, performed the experiments and wrote the paper; TMMVC participated ... subsets We found http://www.retrovirology.com/content/3/1/52 that CCR5-using (R5) HIV-1 is efficiently transmitted to TEM cells but not to TN cells Transmission to TCM cells was of intermediate...
  • 10
  • 245
  • 0
Báo cáo y học: "A paragon of self-tolerance: CD25+CD4+ regulatory T cells and the control of immune responses" pps

Báo cáo y học: "A paragon of self-tolerance: CD25+CD4+ regulatory T cells and the control of immune responses" pps

Ngày tải lên : 09/08/2014, 01:23
... Regulatory T cells in the control of autoimmunity: the essential role of transforming growth factor beta and interleukin in the prevention of autoimmune thyroiditis in rats by peripheral CD4+ CD45RC– ... CD25 +CD4+ cells after stimulation through the TCR and might therefore mediate its effects in a membraneproximal manner [53] The level at which these anti-inflammatory cytokines operate to maintain ... clear-cut and despite intense interest remains strangely inconclusive Potential TR cell suppression mechanisms can basically be divided into those mediated by secreted factors and those requiring intimate...
  • 7
  • 576
  • 0
Báo cáo y học: " Expansion of CD4+CD25+ helper T cells without regulatory function in smoking and COPD" potx

Báo cáo y học: " Expansion of CD4+CD25+ helper T cells without regulatory function in smoking and COPD" potx

Ngày tải lên : 12/08/2014, 13:22
... subject recruitment, bronchoscopies and manuscript preparation All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests Received: ... of T cells into a cytotoxic phenotype This further supports a potential involvement of the acquired immune response in the pathogenesis of COPD To further evaluate the role of regulatory T cells ... staining To obtain FoxP3+ cells, phycoerytrin (PE) conjugated anti-human FoxP3 was used in the same test tube The percentage FoxP3 was determined out of gated CD3+ and CD4+ lymphocytes Statistical analysis...
  • 8
  • 302
  • 0
báo cáo hóa học:" Generation in vivo of peptide-specific cytotoxic T cells and presence of regulatory T cells during vaccination with hTERT (class I and II) peptide-pulsed DCs" pot

báo cáo hóa học:" Generation in vivo of peptide-specific cytotoxic T cells and presence of regulatory T cells during vaccination with hTERT (class I and II) peptide-pulsed DCs" pot

Ngày tải lên : 18/06/2014, 15:20
... Cytotoxicity of In Vivo Generated T Cells T2 -cytotoxicity Cumulative cytotoxicity results for all patient samples show that after two cycles of vaccination (the time point associated with the ... patients with hTERT p540 leads to the production of T cells that not recognize tumour cells in vivo based on this epitope [67-69] In contrast to these studies, the ability of our vaccination strategy ... observed that the generation of tetramer+ CD8 +T cells to hTERT p540 tended to be less efficient compared with hTERT p865 However, in the in vitro cytotoxicity assays, both T cells generated by both...
  • 23
  • 439
  • 0
Báo cáo sinh học: " Complement component C5a Promotes Expression of IL-22 and IL-17 from Human T cells and its Implication in Age-related Macular Degeneratio" potx

Báo cáo sinh học: " Complement component C5a Promotes Expression of IL-22 and IL-17 from Human T cells and its Implication in Age-related Macular Degeneratio" potx

Ngày tải lên : 18/06/2014, 22:20
... unknown factors may also contribute to this T cell activation seen in AMD patients Interestingly, the findings that C5a specifically promoted the Th17 family cytokine production, but not IFN nor ... expression on T cells cultured with or without C5a and C5aR antagonist Ten separate experiments were performed and the figure shows representative data (C) TUNEL staining of CD4+ T cells treated with or ... death We found that monoctytes are necessary for C5a induced Th17 cytokine production through two mechanisms: 1) promoting the direct interaction between monocytes and T cells; 2) indirectly stimulating...
  • 12
  • 389
  • 0
Báo cáo y học: "CD4+CD25+ immunoregulatory T cells may not be involved in controlling autoimmune arthritis" ppsx

Báo cáo y học: "CD4+CD25+ immunoregulatory T cells may not be involved in controlling autoimmune arthritis" ppsx

Ngày tải lên : 09/08/2014, 01:21
... compared with that in naïve mice, suggesting that T cells activated by immunization had become resting memory T cells To further evaluate the role of the CD4+ CD25+ cells in PGIA, an adoptive transfer ... using [3H]thymidine incorporation, and expressed as stimulation index (SI; a ratio of incorporated [3H]thymidine [counts per minute] in antigen-stimulated cultures relative to counts per minute ... regulatory T cells from BALB/c mice with PGIA may mediate the induction of the disease CD4+ CD25+ regulatory T cells may not control autoimmune arthritis To further investigate whether the CD4+ CD25+ T cells...
  • 8
  • 275
  • 0
Báo cáo y học: "Natural killer T cells and rheumatoid arthritis: friend or foe" ppt

Báo cáo y học: "Natural killer T cells and rheumatoid arthritis: friend or foe" ppt

Ngày tải lên : 09/08/2014, 06:22
... suppressive role in the induction phase and a provocative role in antibody-induced joint inflammation A particularly fascinating and novel aspect of the current report is the notion that Vαi NKT cells ... by in vivo neutralization studies in which anti-TGF-β1 treatment was shown to abrogate the protective effect of Vαi NKT cells in CD1d–/– mice, while not affecting joint inflammation in wild-type ... three days after serum transfer Their appearance results in important alterations in cytokine balances within the joints In CD1d–/– mice a marked increase in transcripts of transforming growth...
  • 2
  • 225
  • 0
Báo cáo y học: " T cells and post menopausal osteoporosis in murine models" doc

Báo cáo y học: " T cells and post menopausal osteoporosis in murine models" doc

Ngày tải lên : 09/08/2014, 10:20
... condition and certainly new therapeutic ‘immune’ targets will emerge Competing interests The author declares that they have no competing interests References T cells differentiate in the thymus, ... reconstitution with T cells from TNF deficient mice does not [14] Ovx upregulates T cell TNF production by increasing the number of TNF producing T cells without altering the amount of TNF produced ... responsive element (ERE) element on the TGFβ promoter [21] Thus, estrogen withdrawal leads to increased production of TGFβ in the BM TGFβ receptors are expressed in T cells and TGFβ signaling in T...
  • 4
  • 332
  • 0
Báo cáo y học: "Indoleamine 2,3-dioxygenase-expressing dendritic cells are involved in the generation of CD4+CD25+ regulatory T cells in Peyer''''s patches in an orally tolerized, collagen-induced arthritis mouse model" ppt

Báo cáo y học: "Indoleamine 2,3-dioxygenase-expressing dendritic cells are involved in the generation of CD4+CD25+ regulatory T cells in Peyer''''s patches in an orally tolerized, collagen-induced arthritis mouse model" ppt

Ngày tải lên : 09/08/2014, 10:22
... determining immunity or immune tolerance; this determination is based on the maturation or activation state and the subset of DCs, and cytokine profiles in the microenvironment at the time of antigen ... PCR using IDO sense (5'-CACTGTACCAGTGCAGTAG-3') and antisense (5'-ACCATTCACACACT CGTTAT-3') primers, and using Foxp3 sense (5'-CAGCTGCCTACAGTGCCCCTAG-3') and antisense (5'CATTTGCCACGAGTGGGTAG-3') ... affect the T- cell response In the resting state, autoreactive T cells residing in the periphery are suppressed effectively by regulatory T cells, which are thought to prevent the development of...
  • 10
  • 473
  • 0
Báo cáo y học: "Reduced proportions of natural killer T cells are present in the relatives of lupus patients and are associated with autoimmunity" ppt

Báo cáo y học: "Reduced proportions of natural killer T cells are present in the relatives of lupus patients and are associated with autoimmunity" ppt

Ngày tải lên : 09/08/2014, 13:21
... number not for citation purposes) that are secreted by the NKT cells in the different lupus mouse models, with interleukin-4-secreting NKT cells inhibiting lupus and interferon-γ-secreting NKT cells ... in autoimmunity (c) Cells were stained with anti -CD4 or anti-CD8 (shown) in combination with anti -CD45 RA and anti -CD45 RO to identify naïve (CD45 RA +CD45 RO-; bottom right) and memory (CD45 RA -CD45 RO+; ... defined by the levels of staining with anti-CD27 and anti-CD38, as determined by staining with a relevant isotype control Using this combination of stains, B cells can be divided into naïve transitional...
  • 13
  • 451
  • 0