preparation physicochemical properties and battery applications of a novel poly ionic liquid
Tài liệu Báo cáo khoa học: Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentans ppt
... a CaF2 crystal and allowed to stand at room temperature until all free water was evaporated After this, IR spectra were recorded at room temperature and at 37 °C Usually, the original spectra ... 4¢-phosphate by a galacturonic acid, is biologically, i.e agonistically as well as antagonistically, completely inactive The lack of antagonistic activity may be explained by the fact that this ... as lipid A and MfGl-II represent a mechanical disturbance leading to a conformational change of the protein and, with that, signal transduction Recently, Ben-Menachem et al [45] presented a physicochemical...
- 9
- 665
- 1
Báo cáo khoa học: Inhibitory properties and solution structure of a potent Bowman–Birk protease inhibitor from lentil (Lens culinaris, L) seeds ppt
... found equal to 135 min)1 and to 3.85 min)1 and KM values of 1250 lm and 850 lm for BApNA and GPpNA, respectively, by means of standard LineweaverBurk analysis of initial rate kinetics Fitting of the ... Statistics for the total amount of experimental data are reported in Table A simulated annealing (SA) procedure was used starting from a randomly generated linear polypeptide chain The actual ... bovine pancreas), a- chymotrypsin (TLCK-treated from bovine pancreas), BApNA and GPpNA were purchased from Sigma-Aldrich Solutions of BApNA and GPpNA were freshly prepared by dissolving suitable amounts...
- 16
- 518
- 0
Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx
... subunit molecular mass was also estimated by SDS–PAGE Characterization and comparative analyses of HYDJs and HYDBp The optimal temperature for activity of HYDJs with d-pHPH as substrate was determined ... databases have provided an additional source for identifying d-hydantoinases with high catalytic activity In this study, an approach combining genomic database mining and activity screening was ... HYDJs activity, and intriguingly, mutagenesis of Leu92 to Ala and Val, two smaller hydrophobic residues, actually reduced the catalytic activity to less than approximately 50% of that of the...
- 14
- 621
- 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx
... (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS 4099 Molecular characterization ... PP2500 and ANKHD1 variant In this study we focus on the biochemical and functional characterization of the novel VBARP-L and VBARP-S transcripts Bioinformatics analyses show that VBARP-L and VBARP-S ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1(ANKHD1) variants, and...
- 12
- 561
- 0
Báo cáo khoa học: Identification and functional characterization of a novel barnacle cement protein pptx
... TSVSAGDGAFGNLAAALTLVEDTEDGLGVKTKNGGKGFSEGTAAISQTAGANGGATVKKA VSASAANGFFKNLGKATTEVKTTKDGTKVKTKTAGKGKTGGTATTIQIADANGGVSEKSL AAAAAGNGVFKNLVTALTNISTTDDITKVQTQTIGSGGTGGAATILQLADANGGAALKEV Mrcp19k Bacp19k Bicp19k 130 140 ... Mrcp-19k was amplified from M rosa total cDNA using the primers 5¢-ACC AAC GCA GCA GTT ATG GT-3¢ and 5¢-GCT GCA CAT CTT CGA CCT CA-3¢, and then subcloned KOD-plus DNA polymerase (Toyobo, Osaka, Japan) ... basal tissue of the barnacle by a Total RNA Separator kit (BD Biosciences Clontech, Mountain View, CA, USA), and poly (A) + RNA was isolated using Oligo(dT)-Latex Super (Takara Shuzo Co.) cDNA...
- 11
- 488
- 0
hydrothermal synthesis and crystal structure of a novel one - dimensional tritungstate
... cmy1 are ascribed to Õ ŽW s O., and the features in the 784–889 cmy1 region are most likely associated with Õ ŽO–W–O modes In addition, absorption bands at 1480 and 1624 cmy1 , and a broad band ... initially isolated from the hydrothermal reaction of WO , en, NaOH and H O in polycrystalline form Replacement of NaOH with LiOH produces the same crystalline phase with similar product quality and ... 0.90 A w I ) s Ž I x for 134 parameters and converged to R 1Ž wR s 0.0281Ž0.0634 Atomic coordinates, bond lengths and angles and thermal parameters are presented in supplementary crystallographic...
- 4
- 379
- 0
Báo cáo khoa học: Physiological truncation and domain organization of a novel uracil-DNA-degrading factor pdf
... concentration of 1–6 mgÆmL)1 Analytical ultracentrifugation analysis An Optima XL -A analytical ultracentrifuge (BeckmanCoulter, Palo Alto, CA, USA) was used to perform the analytical ultracentrifugation ... GCA AAT GAA CTG GGC GAT GCG GTC GCA CUA CTT CAC CTC GAA ATC AAC ATC TGA GTG-3¢ (with the uracil position underlined) The complementary oligonucleotide was 5¢-CAC TCA GAT GTT GAT TTC GAG GTG AAG ... BSA and mm EDTA Protein and DNA were mixed, and the mixtures were loaded on agarose gel Analytical gel filtration analysis Analytical gel filtration was conducted on Superdex 200HR column calibrated...
- 15
- 413
- 0
Báo cáo khoa học: Crystal structure determination and inhibition studies of a novel xylanase and a-amylase inhibitor protein (XAIP) from Scadoxus multiflorus pot
... observations indicate that XAIP associates with GH11 xylanase and GH13 a- amylase, as well as with both xylanase and a- amylase simultaneously Tissue distribution of XAIP The output of SDS–PAGE for ... corresponding band was absent in the leaf and flower samples, whereas, in the root sample, a very thin band of XAIP was visible The enzyme inhibition assay using GH11 xylanase and GH13 a- amylase showed maximum ... cleft of a- amylase There are at least 12 hydrogen bonds and ˚ several van der Waals’ contacts (£ 4.0 A) between the two molecules There are at least six common residues of a- amylase that participate...
- 15
- 399
- 0
Báo cáo khoa học " Structure elucidation and antioxidant activity of a novel polysaccharide isolated from Tricholoma matsutake " ppt
... recorded on a Varian Unity INOVA 400/45 in D2 O with tetramethylsilane as internal standard All data were presented as means ± standard deviation (SD) of three replications Statistical analyses were ... T matsutake polysaccharide, named TMP -A, was obtained by the above processes and the yield rate of TMP -A was 0.22% (0.432 g) for the starting material The DPPH− radical scavenging activity of ... TMP -A in comparison to the same doses of Vc At all the concentrations, the polysaccharide samples exhibited varying degrees of antioxidant effect and IC50 value of TMP -A was Fig TMP -A attenuated...
- 5
- 480
- 0
Báo cáo y học: "Demonstration of the histopathological and immunohistochemical effects of a novel hemostatic agent, ankaferd blood stopper, on vascular tissue in a rat aortic bleeding mode" pps
... 1, and the most prominent staining reaction Page of covering nearly the whole area of the specimen was classified as Grade was intermediate between and Statistical analysis Statistical analyses ... hemostasis Aortic sampling was performed in all rats to search for immediate and Day-7 postoperative histopathological changes in vascular tissues as a result of ABS Bleeding assay The duration of ... Laboratory Animal Care” formulated by the National Society for Medical Reseacrh and “Guide for the Care and the Use of Laboratory Animlas” prepared by the US Natinoal Academy of Sciences and published...
- 7
- 454
- 0
Báo cáo y học: "Clinical and serological evaluation of a novel CENP-A peptide based ELISA" pdf
... anti- Page of 14 CENP -A ELISA, CENP-B ELISA (kappa = 0.86) and LIA (kappa = 0.81) was found (Table 1) Association between anti-CENP -A and anti-CENP-B reactivity by ELISA The anti-CENP -A and anti-CENP-B ... and take responsibility for the integrity of the data and the accuracy of the data analysis Data acquisition was courtesy of MM, LM, RW, DB, XB, GR, KE, SS, FH, AS, IG and MJF Statistical analysis ... interests Authors' contributions MM and MJF take responsibility for the study design, analysis and interpretation of data, and manuscript preparation MM and MJF had full access to all of the data in...
- 14
- 347
- 0
Applications of a novel cho glycosylation mutant
... 32 ACTAGCCTTAAAGACAGACAGCTTTGTTCTAGTCAGCCAGGCAAGCATATGTAAATAAAGTTCCTCAGG GAACTGAGGTTAAAAGATGTATCCTGGACCTGCCAGACCTGGCCATTCACGTAAACAGAAGATTCCGCC TCAAGTTCCGGTTAACAACAGGAGGCAACGAGATCTCAAATCTATTACTTCTAATCGGGTAATTAAAAC ... ACCTCCTCAGTGGAAGGTAATTTGGGGTTAAGATGAGGATTTCTAGGGTTTGTATGAAGCAAGATTTCC AATGCAGACGTGGAAGTGCGAAGTCTCCCGTGGGAATCTGGGAACTTTGCTTCTTGGCAGAAATTTTTG TGCTGTTCCCAGAGTTTATTAAGCATCCTCTTTATATACAAAATATTTGAAATTTTGTTAGCAAGAGCA GTT The ... TGCCCGCGGTGATCCCCATGCTGTGCCAGCCTTTGCCCAGAGGCGCTCTAGCTGGGAGCAAAGTCCGGT CACTGGGCAGCACCACCCCCCGGACTTGCATGGGTAGCCGCTGAGATGGAGCCTGAGCACACGTGACAG GGTCCCTGTTAACGCAGTGTTTCTCTAACTTTCAGGAACGAATTCAAGTACTTCCAAAGAATGACCACC ACCTCCTCAGTGGAAGGTAATTTGGGGTTAAGATGAGGATTTCTAGGGTTTGTATGAAGCAAGATTTCC...
- 127
- 240
- 0
Genomic organization and functional characterization of a novel cancer associated gene u0 44
... mammals (Bandyopadhyay et al., 1999; Bandyopadhyay et al., 2002) It contains a signal peptide at the N-terminus, a ZP domain, a C-terminal putative TMD, and a cytoplasmic tail (Lopez-Casillas ... Molecular Cloning and Characterization of a Putative Oncogene, HuUO-44, in Human Ovarian Carcinogenesis Awarded AVON international scholar-in-training award poster presented at the 94th American Association ... Northern, Cancer Profiling Array and Cancer Cell Line Profiling Array 3.9 Semi-quantitative RT-PCR of Human and Rat UO-44 3.10 Quantitative (Real-time) PCR of UO-44 3.11 Generation and Transfection...
- 198
- 331
- 0
Identification, characterization and expression analysis of a novel TPA (12 0 tetradecanoylphorbol 13 acetate) induced gene
... that the activation of telomerase is a late event (58-60) BRCA2 Inherited BRCA2 mutations are typically associated with familial breast and ovarian cancer syndrome, but also carry a significant ... epidemiological and genetic studies Pancreatic adenocarcinoma is a disease that is associated with advancing age (12) It is rare before the age of 40, and culminates in a 40 fold increased risk by the age ... (20-22) A molecular and pathological analysis of evolving pancreatic adenocarcinoma has revealed a characteristic pattern of genetic lesions The challenge now is to understand how these signature...
- 118
- 501
- 0
Tài liệu A Dissertation on the Medical Properties and Injurious Effects of the Habitual Use of Tobacco pptx
... elasticity, and his speaking was no more annoyed by a relaxation of them A respectable man of my acquaintance, about forty years of age, who commenced chewing tobacco at the age of eighteen, was for a ... gratification of appetites, regardless of others, is the strongest feature of barbarism We see then, even as a dictate of refinement, that the use of tobacco should be abandoned; and it has been abandoned ... rum, as an antidote against a damp atmosphere Another, to prevent the accumulation of water or bile in his stomach; and a third, as a security against the encroachment of contagious diseases...
- 29
- 586
- 0
Báo cáo khoa học: Physicochemical properties and distinct DNA binding capacity of the repressor of temperate Staphylococcus aureus phage /11 doc
... 5'CATTTTCTTACCTCCTTAAATTTACCTATAGTATAACCCAATTATTTTTGGTATTCA GTAAAAGAATGGAGGAATTTAAATGGATATCATATTGGGTTAATAAAAACCATAAGT * O1 cl * * –80 O2 O2 –70 –60 –50 –40 –30 O1 O2 * ACAAAAAAATACACGAAAAGCAAACTTTTATGTTGACTCAAGTACACGTATCGTGTAT TGTTTTTTTATGTGCTTTTCGTTTGAAAATACAACTGAGTTCATGTGCATAGCACATA ... DNAs Synthesis of O DNA Synthesis of O1DNA pHC2 GAATTCTTGGTTCTATAGTATCTG PCR11 GACTCAAGTACACGTATCGTGTATA GTAGGTTTA PCR21 AAACCTACTATACACGATACGTGTA CTTGAGTCA IIa ATTCAACAAAAAAATACACGAAAAG CAAACTTTTATGTTGACTCAAGTA ... CAAACTTTTATGTTGACTCAAGTA IIb TACTTGAGTCAACATAAAAGTTTGC TTTTCGTGTATTTTTTTGTTGAAT PCI51 GAATTCTCGCTAATTCTTTTTTATC IIId TTTTTTTGTTGAATACCAAAAATAA TTGGGTTATACTATAG CSP4 CATGCCATGGATGAATAACGGTACAG CSP6...
- 11
- 432
- 0
![Báo cáo khoa học: Properties and significance of apoFNR as a second form of air-inactivated [4Fe-4S]ÆFNR of Escherichia coli pot](https://media.store123doc.com/images/document/14/rc/at/small_ata1395562826.jpg)
Báo cáo khoa học: Properties and significance of apoFNR as a second form of air-inactivated [4Fe-4S]ÆFNR of Escherichia coli pot
... residues reacted with DTNB (Table 1) The residues 4261 Disulfides of apoFNR Fig MALDI-TOF spectra of aerobically (A) and anaerobically (B) prepared and carboxymethylated apoFNR The samples of apoFNR ... signal The MALDI-TOF spectrum of anaerobic apoFNR consisted of one major signal at 28 408 Da after alkylation equivalent to fivefold alkylated apoFNR, and a minor signal of threefold alkylated FNR ... aerobically and anaerobically prepared apoFNR Aerobically or anaerobically prepared apoFNR were incubated with GnHCl + iodoacetate and digested with trypsin, and after separation on Sephadex Peptide...
- 10
- 477
- 0
Báo cáo sinh học: " Research Article Applications of a Weighted Symmetrization Inequality to Elastic Membranes and Plates" pptx
... circular plate of variable thickness,” Indian Journal of Pure and Applied Mathematics, vol 11, no 2, pp 258–267, 1980 10 H D Conway, “The bending of symmetrically loaded circular plates of variable ... 2 Journal of Inequalities and Applications ∗ where C is a constant depending on a x and h x , whereas Ω∗ and fμ denote μ symmetrizations of Ω and f, with respect to the measure μ, respectively; ... “Symmetrization and mass comparison for degenerate nonlinear parabolic and related a elliptic equations,” Advanced Nonlinear Studies, vol 5, no 1, pp 87–131, 2005 J E Brothers and W P Ziemer, “Minimal...
- 12
- 177
- 0
Báo cáo y học: " Chemical fingerprinting and quantitative analysis of a Panax notoginseng preparation using HPLC-UV and HPLC-MS" pdf
... [Journal of Pharmaceutical and Biomedical Analysis 41 (2006) 274-279], (B) [Journal of Pharmaceutical and Biomedical Analysis 48 (2008) 1361-1367], (C) [Journal of Pharmaceutical and Biomedical Analysis ... The similarities of chromatograms of 10 samples (n = 3) Additional file 3: PDA Chromatograms standard compounds (A) and a XST injection (C), and total ion current chromatograms of standard compounds ... and quantitative analysis and wrote the manuscript PYS and QS assisted HY to identify the characteristic peaks using HPLC-PDA/ESI-MSn All authors read and approved the final version of the manuscript...
- 8
- 471
- 0
Báo cáo y học: " Cable properties and propagation velocity in a long single chain of simulated myocardial cells" docx
... chapter 24: Cable properties and propagation of action potentials Appendix I: Academic Press; 2001::407 Cohen SA: Immunocytochemical localization of rH1 sodium channel in adult rat heart atria ... electrical equivalence of physiological parameters A simulation study by PSpice can be made as accurate as using the mathematical model Additionally, PSpice provides the ability to vary the parameters ... contain fast Na+ channels at a higher density than that in the surface sarcolemma [9,15,16] Transverse propagation also occurred by the same EF mechanism between adjacent parallel chains that...
- 11
- 326
- 0
Tìm thêm: khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25