preparation of a naïve library of camelid single domain antibodies

Báo cáo khoa học: Llama single-domain antibodies directed against nonconventional epitopes of tumor-associated carcinoembryonic antigen absent from nonspeciﬁc cross-reacting antigen doc

Ngày tải lên : 23/03/2014, 05:22

... loopdomain in NCA, compared with three tandemly repeated loop-domains in CEA Comparisons between the extracellular domains of CEA and NCA show that the N-terminal and adjacent loop-domains of each ... of singledomain antibodies (sdAbs) consisting of the variable domain of these heavy chain antibodies, also named VHH [2] These minimal antibody domains are endowed with a large number of properties ... J, Baty D, Barbet J et al (2007) Generation of llama singledomain antibodies against methotrexate, a prototypical hapten Mol Immunol 44, 1680–1690 Lauwereys M, Arbabi Ghahroudi M, Desmyter A, ...

13
529
0

Báo cáo khoa học: Bacterial IscU is a well folded and functional single domain protein pdf

Ngày tải lên : 23/03/2014, 12:20

... all datasets, the absorbance of the depleted area at a ﬁnal speed of 40 000 r.p.m provided an experimental value for the baseline offset The data were analysed with the ORIGIN XL -A/ XL1 package (Beckman) ... from the peak intensity ratios of amide resonances obtained by recording interleaved 2D Watergate 1H-15N HSQC spectra with and without a saturation delay of s and a repetition delay of 4.2 s [28] ... 2-mercaptoethanol Lower panel: Experimental absorbance at 280 nm as a function of the radial position and data ﬁtting to the equation reported in Materials and methods Upper panel: Distribution of differences...

8
303
0

Báo cáo khoa học: Identiﬁcation of calreticulin as a ligand of GABARAP by phage display screening of a peptide library pdf

Ngày tải lên : 16/03/2014, 05:20

... folded GABARAP [22] The addition of CRT to GABARAP resulted in the disappearance of GABARAP resonances, a clear indication of binding (Fig 3B) Only weak amide signals for a Gln ⁄ Asn side chain and ... et al (2001) Functional specialization of calreticulin domains J Cell Biol 154, 961–972 Harada K, Takeuchi H, Oike M, Matsuda M, Kanematsu T, Yagisawa H, Nakayama K-II, Maeda K, Erneux C & Hirata ... interact with CRT By contrast with GABARAP, no quantitative data are available for these interactions Most importantly, the interaction of CRT with GABARAP occurs with natively folded GABARAP This...

13
560
0

preparation of fe2o3 submicro - flowers by a hydrothermal approach

Ngày tải lên : 20/03/2014, 13:06

... through a hydrothermal method using Span80 or L113B as a soft template [17] Wan et al have proposed a soft-template-assisted hydrothermal route to prepare single crystal nanorods with an average diameter ... voltage increases, and the amplitude of the plateau is markedly reduced, so that only a discharge slope is observed, with a decrease in the discharge capacity The initial discharge capacities of ... Probably due to the ﬁne particle size and large surface area, the material shows superior electrochemical performance, with a high initial capacity of 905.8 mAh/g and good capacity retention of...

6
382
0

Báo cáo khoa học: A strategy for the generation of speciﬁc human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Ngày tải lên : 23/03/2014, 13:20

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...

11
679
0

Báo cáo toán học: " Selective preparation of zero- and onedimensional gold nanostructures in a TiO2 nanocrystal-containing photoactive mesoporous template" pdf

Ngày tải lên : 20/06/2014, 21:20

... gold nanoparticles using a surfactant template Adv Mater 2001, 13:1389 15 Kawamura G, Nogami M: Application of a conproportionation reaction to a synthesis of shape-controlled gold nanoparticles ... affects photocatalytic activity of periodic mesoporous nanocrystalline anatase thin films J Mater Chem 2007, 17:82 27 Aprile C, Corma A, Garcia H: Enhancement of the photocatalytic activity of ... http://www.nanoscalereslett.com/content/7/1/27 Page of Figure DR spectra of Au3+ ion-adsorbed 20Ti and 0Ti and of 1-D GNSs (A) DR spectra of Au3+ ion-adsorbed 20Ti and 0Ti before and after UV irradiation...

8
370
0

Báo cáo hóa học: " A Novel Route for Preparation of Hollow Carbon Nanospheres Without Introducing Template" ppt

Ngày tải lên : 22/06/2014, 00:20

... polymerization and carbonization of alginate according to the theory of the rate of chemical reaction The ﬁlling ratio as an important parameter of hydrothermal systems has a critical inﬂuence ... may be explained why carbonization of alginate needed higher temperature than for carbonization of glucose Then nucleation of alginate took place when critical supersaturation of alginate was ... formation of cross-linked hollow spheres These results revealed that temperature was a key factor in the preparation of carbon nanospheres through dehydration, aromatization, and carbonization At...

6
349
0

Báo cáo y học: "Prolastin, a pharmaceutical preparation of purified human α1-antitrypsin, blocks endotoxin-mediated cytokine release" potx

Ngày tải lên : 12/08/2014, 18:21

... also in extrahepatic cells, such as monocytes, macrophages and pulmonary alveolar cells [3,4] The average concentration of AAT in plasma in healthy individuals is 1.3 mg/ml, with a halflife of ... Corporation, Clayton, North Carolina, USA) This vial of Prolastin contained 1059 mg of functionally active AAT, as determined by capacity to inhibit porcine pancreatic elastase Prolastin was dissolved ... for nasal lavage was performed according to a method described by Wihl and co-workers [41] Each nasal cavity was lavaged separately with a syringe (60 ml) to which a plastic nasal olive was connected...

11
237
0

Báo cáo sinh học: "Construction and characterization of a BAC library from a gynogenetic channel catﬁsh Ictalurus punctatus" pps

Ngày tải lên : 14/08/2014, 13:22

... Katagiri T., Asakawa S., Hirono H., Aoki T., Shimizu N., Genomic bacterial artificial chromosome library of the Japanese flounder Paralichthys olivaceus, Mar Biotechnol (2000) 571–576 [13] Katagiri ... [18] Rogel-Gaillard C., Bourgeaux N., Billault A. , Vaiman M., Chardon P., Construction of a swine BAC library: application to the characterization and mapping of porcine type C endoviral elements, ... Katagiri T., Asakawa S., Minagawa S., Shimizu N., Hirono I., Aoki T., Construction and characterization of BAC libraries for three fish species; rainbow trout, carp and tilapia, Anim Genet 32...

11
244
0

Báo cáo y học: " Preparation of RGD-modified Long Circulating Liposome Loading Matrine, and its in vitro Anti-cancer Effects"

Ngày tải lên : 26/10/2012, 08:57

... Y Preparation and in vitro evaluation of liposomal chloroquine diphosphate loaded by a transmembrane pH-gradient method Int J Pharm 2008; 361:56-63 Maitani Y, Aso Y, Yamada A, et al Effect of ... growth rate was calculated as A5 70 (test) /A5 70 (control) We assumed that the average A5 70 values of the control group were equal to 1, and then generated a histogram of cellular viability according ... cytometric analysis (Coulter-XL, USA) within h of staining All experiments were repeated three times Statistical analysis The SAS statistical software was used for statistical analyses The results are...

12
635
0

Tài liệu Experiment 17 Preparation of Methyl Orange ppt

Ngày tải lên : 12/12/2013, 21:16

... mL beaker and add enough hydrochloric acid of a 6M or a 12 M solution in order to provide a total of 0.030 mol HCl in your beaker Add the sulfanilate solution prepared above in a fine stream while ... mole of sulfanilic acid (anhydride) in about 50 ml of a solution of sodium carbonate containing 0.010 to 0.0125 moles of sodium carbonate in a 125 ml Erlenmeyer flask The solution is prepared ... is alkaline If not, add a small amount (1-2 mL) sodium carbonate solution and check the pH again Then add 0.010 moles sodium nitrite and cool to 25 °C (room temperature) Put 40 g of ice in a 400...

5
529
0

Tài liệu EXPERIENCE OF THE INSTITUTE OF ENERGY IN THE PREPARATION OF THE RENEWABLE MASTER PLAN docx

Ngày tải lên : 24/01/2014, 03:20

... Financing is limited due to regulation Time is limited Inadequate database Lack of information, analysis, and assessment on potential RE resources, cost, and benefits of environment Lack of manpower ... (equivalent more than 10 million tons of oil) Types of biomass can be exploited at the industrial scale: rice husks; leaves, top of sugar canes & baggage; coffee husks and wood residues Institute of ... on potential of renewable energies Solar Energy Over 100 solar measurement stations throughout the country Average solar radiation is kWh/m2 per day Average number of sunny hours is about 2000-:-2500...

12
705
0

Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc

Ngày tải lên : 18/02/2014, 16:20

... pAM237 pAM241 pAM252 pAM253 pAM872 pAM873 pAM874 pAM875 pAM876 pAM877 pAM878 pAM879 pAM880 pAM881 pAM882 pAM883 pAM884 pAM885 pAM886 pAM887 pAM888 pAM889 pAM890 pAM891 pAM892 pAM895 pAM896 pAM899 ... GFP-speciﬁc antiserum was a gift from J Kahana and P Silver (Dana Farber Cancer Center, Boston, MA) The anti-actin mAb was MAB1501 from Chemicon International (Temecula, CA) The anti-hexokinase rabbit ... CAAX box of Ras1p (C-Vrp1p364)760–CAAX) Each strain was streaked for single colonies on YPUAD solid medium, incubated at either 24 or 37 °C, and photographed after days (B) Addition of a CAAX...

23
679
0

Tài liệu Báo cáo khoa học: Crystal structure of the catalytic domain of DESC1, a new member of the type II transmembrane serine proteinase family pptx

Ngày tải lên : 19/02/2014, 00:20

... structure of the catalytic domain of DESC1 Scheme Domain organization of human DESC1 membrane region The extracellular part of DESC1 consists of a 120-amino acid SEA domain followed by the C-terminal ... growth factors and proteinase inhibitors Biol Chem 380, 473–483 Kataoka H, Uchino H, Asada Y, Hatakeyama K, Nabeshima K, Sumiyoshi A & Koono M (1997) Analy- Crystal structure of the catalytic domain ... favored and favored regions of the Ramachandran ˚ plot and r.m.s.d values for bond and angle of 0.005 A and 1.37 ° as shown in Table References Table Data collection and reﬁnement statistics of...

13
588
0

Tài liệu Báo cáo khóa học: The PAS fold A redeﬁnition of the PAS domain based upon structural prediction ppt

Ngày tải lên : 19/02/2014, 12:20

... contain a PAC motif, and conversely that all PACannotated A thaliana proteins contain a PAS domain Therefore, in the case of A thaliana, the PAS and PAC motifs are inseparable, indicating that the annotation ... 273–379 P39272 233–339 PFAM PAC NA NA NA NA NA NA NA NA NA NA PAC PAC PAC PACa PAC PAC PAC PAC PAC PAC PAC PAC PAC NA NA B_19516 PROSA z-score (best model) z-Score after Align-2D (best model) )6.04 ... FEBS 2004 A redeﬁnition of the PAS domain (Eur J Biochem 271) 1205 Fig Alignment of all A thaliana sequences that are either annotated as a PFAM PAS domain or as a PFAM PAC motif Regions of sequences...

11
592
0

Báo cáo khoa học: Molecular basis of perinatal hypophosphatasia with tissue-nonspeciﬁc alkaline phosphatase bearing a conservative replacement of valine by alanine at position 406 Structural importance of the crown domain potx

Ngày tải lên : 07/03/2014, 05:20

... infantile hypophosphatasia, (c) childhood hypophosphatasia, (d) adult hypophosphatasia and (e) odonto hypophosphatasia [1–4] Perinatal and infantile forms of hypophosphatasia are severe and are ... hypophosphatasia Eur J Med Genet 50, 367–378 Cai G, Michigami T, Yamamoto T, Yasui N, Stomura K, Yamagata M, Shima M, Nakajima S, Mushiake S, Okada S et al (1998) Analysis of localization of mutated tissue-nonspeciﬁc ... V406I, 5¢-CCT GGC TAC AAG ATA GTG GGC GGT GAA-3¢ and 5¢-TTC ACC GCC CAC TAT CTT GTA GCC AGG-3¢; and V406F, 5¢-CCT GGC TAC AAG TTC GTG GGC GGT G-3¢ and 5¢-CAC CGC CCA CGA ACT TGT AGC CAG G-3¢, respectively...

11
500
0

Báo cáo Y học: Crystal structure of the catalytic domain of a human thioredoxin-like protein pdf

Ngày tải lên : 08/03/2014, 22:20

... Murakawa, M., Takahashi, S., Tsubuki, S., Kawashima, S., Sakamaki, K & Yonehara, S (1998) Purification, molecular cloning, and characterization of TRP32, a novel thioredoxin-related mammalian ... in length and contains an 867-bp ORF, which encodes for a protein with 289 amino acids and a calculated molecular mass of 32 kDa A search of the nonredundant protein sequence database was performed ... smoothly in alternating steps of automatic adjustment with CNS and manual adjustment with the program O [34] The final model has a final R-factor of 0.222 with a free R-factor of 0.253 Molecular graphics...

9
533
0

Preparation of dairy products potx

Ngày tải lên : 08/03/2014, 22:20

... Greater financial gain may be obtained Apart from these reasons, it should also be realised that many population groups in Asia and Africa cannot or can hardly consume milk because of so-called ... container for churning ? a sieve ? a bowl ? a tray for kneading ? wooden spoons ? fine salt if available (optional) ? packing material, e.g greaseproof paper or a jar ? clean water 46 Preparation ... udder of a healthy animal contains almost no microorganisms (aside from lactic acid bacteria) After the milk leaves the 18 Preparation of dairy products udder contamination with, sometimes harmful,...

86
391
0

Mechanical preparation of root canals: shaping goals, techniques and means potx

Ngày tải lên : 09/03/2014, 00:20

... carried out with software that separates virtual root canals, automatically detects the canal axis and its changes after preparation and the amount of preparared root canal surface area ¨ The Gottingen ... Post-instrumentation area was also greater in comparison with Lightspeed preparation (224), following ultrasonic preparation or rotary Canal Master preparation and equal to hand preparation using the stepback ... recent literature few data on preparation of oval shaped root canals are available Such cross-sectional shapes can often be found in the distal root canals of mandibular molars or in mandibular incisors...

47
924
0

Báo cáo " Preparation of nano-structural MnO2 in ethanol-water media coated on calcinated laterite and study of its arsenic adsorption capacity " docx

Ngày tải lên : 14/03/2014, 10:20

... for particle size analysis and coating on denaturated laterite material The productivity of nanodimensional MnO2 formation was calculated as percentage of mass ratio between amount of nanodimensional ... (similar of [9]) , while the Cmax of nano MnO2 coated material reached to value of 138,89 mg/g In competition, the maximum adsorption capacity of nano MnO2 coated material was sharply increased ... nanodimensional MnO2 taken and theoretical amount upon reaction stoichiometry Coating of nanodimensional MnO2 on denaturated laterite was realized as below: weighed suitable amount of dried denaturated laterite...

6
516
0