... complementary (5¢-CACCGCAGTGCCATGGAAGGAGTTTC CACACGAATGTGGAAACTCCTTCCATGGCACTG-3¢) according to the manufacture’s protocol (Invitrogen, Carlsbad, CA, USA) Transfections with various DNA constructs ... F-actin in a direct manner Formation of higher order actin structures, such as bundles and cables, is crucial to stabilize the organization of transvacuolar strands and maintain overall cellular ... mutations into each LIM domain: LIM1(10Cys fi Ser, 13Cys fi Ser):5¢-GGA GGCGCAAAATCTGGAGCCTCTGAAAAGACCGTCTA C-3¢; LIM2(120Cys fi Ser, 123Cys fi Ser): 5¢-GAGAGTCC GAGAAGTCCCCTCGATCTGGCAAGTCAGTCTATG-3¢...
... that is used as the language of aviation, international sport and pop music It is also the English language that is used as an official language in 44 countries, and as the language of business, ... perceive and use proverbs Proverbs are considered to be special factors of a language’s vocabulary system because they reflect cultural special characteristics of each nation, including material and ... 100% Total 18 4.2.3 Semantic Similarities and Differences of Proverbs Relating to Gain and Loss in English and Vietnamese a Similarities It can be clearly seen that both English and Vietnamese...
... Okawa, K., Iwamatsu, A. , Fujita, A. , Watanabe, N., Saito, Y., Kakizuka, A. , Morii, N & Narumiya, S (1996) The small GTP -binding protein Rho binds toand activates a 160 kDa Ser/Thr protein kinase ... Madaule, P., Reid, T., Ishizaki, T., Watanabe, G., Kakizuka, A. , Saito, Y., Nakao, K., Jockusch, B.M & Narumiya, S (1997) p140mDia, a mammalian homolog of Drosophila diaphanous, isa target protein ... Biol 17, 2247–2256 13 Watanabe, G., Saito, Y., Madaule, P., Ishizaki, T., Fujisawa, K., Morii, N., Mukai, H., Ono, Y., Kakizuka, A & Narumiya, S (1996) Protein kinase N (PKN) and PKN -related protein...
... 5’-CCGGGATCCATGAAAAAAATCAT-3’ hmuY_XhoI_Rev 5’-AATCTCGAGTTATTTAACGGGGTA-3’ hmuY_BamHI_Fwd 5’-CGCGGATTCATGGCTCTTCACCGCTATGA-3’ hmuY_XhoI_Rev 5’-AATCTCGAGTTATTTAACGGGGTA-3’ ermF_ClaI_Fwd 5'- CCATCGATGGGATAGCTTCCGCTATTGC-3' ... genetic arrangement of ragAB locus is also similar to those transport systems for transferrin and lactoferrin in Neisseria and Haemophilus sp where a lipoprotein is usually co-transcribed with a TonB-linked ... (Abiko et al., 1990) HBP35 protein was found to function as a coaggregating factor toward Actinomyces viscosus and appears to confer colonizing ability to P gingivalis (Hiratsuka et al., 1992)...
... of PA-oligosaccharides, GalNAca1-3(Fuca1-2)Galb1-3(Fuca1-4)GlcNAcb1-3Galb14Glc-PA and Neu5Aca2-6Galb1-4GlcNAcb1-2Mana16(Neu5Aca2-3Galb1-3(Neu5Aca2-6)GlcNAcb1-4(Neu5Aca26Galb1-4GlcNAcb1-2)Mana1-3)Manb1-4GlcNAcb1-4GlcNAc-PA ... Major natural location PA sugars that showed affinity for At3g16450.1 (Glca1-4Glc)3 maltohexaose (Glca1-6Glc)3 isomaltohexaose Gala1-4Galb1-4Glc GalNAca1-3(Fuca1-2) Galb1-3(Fuca1-4)GlcNAcb1-3Galb1-4Glc ... Tetrasialyl PA glycan Neu5Aca2-6Galb1-4GlcNAcb1-2Mana1-6(Neu5Aca2-3Galb1-3(Neu5Aca2-6)GlcNAcb1-4(Neu5Aca2-6Galb14GlcNAcb1-2)Mana1-3)Manb1-4GlcNAcb1-4GlcNA-PA was used as a control sugar to determine...
... CGGGGATCCGCATCGGAACAAAACAATAC AATCCCGGGTTACTTTAGTTTATCTTTGCCG GGGGGATCCGGTACAGATGTAACAAATAAAG ATTCCCGGGTAATTTTTCCAAGTTAAATTACTTG GGGGGATCCGGTACAGATGTAACAAATAAAG CTCCCCGGGCTATTGAATATTAAATATTTTGCTAA ... CCCGGATCCTATTTAGGTGGAGTTAGAGATAAT AATCCCGGGTTACTTTAGTTTATCTTTGCCG GAATTATCTTTAGCTCTAGCTATTGATCC GGATCAATAGCTAGAGCTAAAGATAATTC GCAGAATTCGTCGGCTTGAAATACGCTG AATGGATCCTTACTTTAGTTTATCTTTGCCG CCCAAGCTTGATGATGTCAGC ... virulence factors that allow S aureus to adhere to the surface of host cells andto damaged tissue, and help it to avoid phagocytosis by neutrophils [3,4] The fibronectin -binding proteins (FnBPs) A and...
... L-Ala-(Gly)2 (L-Ala)2, L-Ala-D-Ala, L-Ala-D-Ala-L-Ala, DL-Ala-DL-Asn, DL-Ala-DL-Ile, DL-Ala-DL-Leu, DL-Ala-DL-Met, DL-AlaDL-Phe, DL-Ala-DL-Ser, DL-Ala-DL-Val, L-Asp-D-Ala, L-Pro-Gly, L-ProL-Phe, c-Aminobutyryl-L-His ... L-Ala-pNA D-Ala-NH2 L-Ala-NH2 D-Ala-(Gly)2 L-Ala-(Gly)2 b-Ala-L-Ala b-Ala-Gly b-Ala-NH2 b-Ala-L-His (Carnosine) b-Ala-L-Leu (b-Ala)2 similarity to that from dmpA of O anthropi LMG7991 DmpA has been ... Pseudomonas aeruginosa and Lactobacillus delbrueckii ssp lactis DSM 7290 Van der Drift and Ketelaars have isolated a bacterium hydrolyzing b-Ala-l-His (l-carnosine) and identified it as P aeruginosa...
... 250 kDa protein; and lane M, molecular mass standards (myosin heavy chain, 220 kDa; myosin light chain 1, 26 kDa; myosin light chain 2, 18 kDa) (B) Immunocrossreactivity: monomeric 250 kDaprotein ... storage and uptake activity of the 250 kDaprotein (A) Detection of iron in the 250 kDa protein: potassium ferrocyanide was added toa final concentration of 10 mM to all of the fractions obtained ... R Hasan et al with an approximate molecular mass of 250 kDa, was reported as a putative MAP, on the basis of various properties such as electrophoretic mobility, heat stability and immunoreactivity...
... NP042023) Additional bornavirus G sequences used in the analyses included ABH0 3174 , CAC70658 (horse), AAL49985 (sheep), ABH03169 (rabbit), ACG59352 (avian - Aratinga solstitialis), and AAA91195 (human) ... Carbone KM, Duchala CS, Griffin JW, Kincaid AL, Narayan O: Pathogenesis of Borna disease in rats: evidence that intraaxonal spread is the major route for virus dissemination and the determinant ... Rhabdoviridae G class III F Paramyxoviridae HA TPMV-like class henipa class I I Paramyxovirinae pre class I, II, III Pneumovirinae F HA class class I I Paramyxoviridae avula metapneumo Mononegavirales...
... We also thank Mrs Izaíra T Brandão and Mrs Ana P Masson for technical assistance This study was supported by grants from Fundação de Amparo Pesquisa Estado de São Paulo (FAPESP), Programa Nacional ... beta-actin was detected by PCR using cDNA and betaactin-specific primers (sense 5' ATGTTTGAGACCTTCAACA-3' and antisense 5'-CACGTCAGACTTCATGATGG-3'; giving a 495-bp band) The PCR products were visualised ... amplification was carried out using μL of cDNA preparation and specific primer pairs of M leprae Hsp65 (sense 5'-TCAAGGTGGCGTTGGAAGC-3' and antisense 5'-CCGTGACCCACTGAAAGGTTA-3'; giv- Page of 11 (page...
... the analysis On this basis, the theoretical installed wind capacity potential for Cambodia, the Lao PDR, Myanmar, Thailand, and Viet Nam was estimated to be 888 gigawatt (GW), and the theoretical ... sector Inadequate or limited access to capital, as well as lack of technical and financial support Lack of a mandatory policy for use of biofuels and lack of specific targets on production and ... Potential of Agricultural Residues: Thailand 7.7 Land Requirement for Palm Oil as Biodiesel Feedstock: Thailand 7.8 Land Requirement for Sugarcane as Bio-Ethanol Feedstock: Thailand 7.9 Land...
... same message in another language The text to be translated is called the "source text," and the language that it isto be translated into is called the "target language"; the final product is ... translation is that the text in TL sounds more natural On the contrary, the disadvantage is that translating is too casual to understand the original because of its freedom ◊ Adaption: This is the ... terminology databases especially appropriate In his book Technical Translation, Jody Byrne argues that technical translation iscloselyrelatedto technical communication and that it can benefit...
... „Typically, formal correspondence distorts the grammatical and stylistic patterns of the receptor language, and hence distorts the message, so as to cause the receptor to misunderstand or to labor ... (Nida and Taber, 1982:200) Nida (1964) distinguishes formal equivalence and dynamic translation as basic orientations rather than as a binary choices: Formal equivalence is achieved when the SL and ... study This research is carried out with view to help learners enlarge their vocabulary and have general understanding about translation and translation of the astronomy and geography terms All of...
... hyperthemophilic bacteria Aquifex aeolicus, Thermotoga maritima and Thermoanaerobacter tengcongensis not encode aproteinrelatedto bacterial DsbA and no DsbA-like protein in Archaea were found, ... Hosoyama, A. , Fukui, S., Nagai, Y., Nishijima, K., Otsuka, R., Nakazawa, H., Takamiya, M., Kato, Y., Yoshizawa, T., Tanaka, T., Kudoh, Y., Yamazaki, J., Kushida, N., Oguchi, A. , Aoki, K., Masuda, S., ... 49 Kawarabayasi, Y., Hino, Y., Horikawa, H., Yamazaki, S., Haikawa, Y., Jin-n., o, K., Takahashi, M., Sekine, M., Baba, S., Ankai, A. , Kosugi, H., Hosoyama, A. , Fukui, S., Nagai, Y., Nishijima,...
... and classified diseases and disabilities which may affect human beings for example the entities listed in the items listed in the International Statistical Classification of Diseases andRelated ... on the health and function (that is, disease and disability prevalence) of the population [26] Closing the loop to show how 'Health Impact' and 'Health and Function' affect the inflows and outflows ... with disabilities, and some with disease, thus generating the need for clinical health care For a range of reasons including personal choice, fears and prejudice, geographic and financial accessibility,...
... discussions and help Special thanks to Ali Khalifa, Mona Kamar, and Nafisa Hassan for their efforts and help through this paper Author Details 1Informatics and Systems Department, Division of Engineering ... Collection and Analysis We downloaded all available annotated HCV NS 5A sequences from subtypes 1a, 1b, and 3a from the HCV LANL database [16] (See Table 1) Factors affecting the response to therapy ... interpretable set of rules than traditional classification approaches [28,29] Analysis of the genetic distance variations, VESPA, and relative Shanon entropy (Table 1, Figure and Additional files and...