0

poly i c leads to better survival in tc 1 tumor bearing mice

Tài liệu Báo cáo khoa học: Lipopolysaccharide-evoked activation of p38 and JNK leads to an increase in ICAM-1 expression in Schwann cells of sciatic nerves ppt

Tài liệu Báo cáo khoa học: Lipopolysaccharide-evoked activation of p38 and JNK leads to an increase in ICAM-1 expression in Schwann cells of sciatic nerves ppt

Báo cáo khoa học

... LPS increases ICAM -1 expression in Schwann cells of sciatic nerves A B C D Fig LPS induced the expression of ICAM -1 protein in cultured SCs (A) LPS induced ICAM -1 protein expression in a concentration-dependent ... Nuclear factor jB (NF-jB), a critical participant in cytokine-induced ICAM -1 upregulation [5,7,22,23], mediates the rapid induction of cytokines and adhesion molecules that are implicated in immune ... potential immune functions, similar to the non-myelinating glia of the CNS SCs can be induced to produce cytokines and chemokines, to express major histocompatibility complex (MHC) class II molecules...
  • 11
  • 519
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Reduced expression of Jak-1 and Tyk-2 proteins leads to interferon resistance in Hepatitis C virus " docx

Hóa học - Dầu khí

... chronic HCV infection is a combination of IFN-α and ribavirin, but the majority of chronic hepatitis C patients cannot clear their infection with this regimen Patients infected with genotype HCV in ... found to be similar Discussion Interferon alpha in combination with ribavirin is the standard treatment for patients with chronic hepatitis C virus infection This therapy can eliminate virus infection ... of interferon specifically bound was determined by subtracting non-specific binding from total binding Specific binding of 12 5I- IFN-α2b to three groups of resistant cell lines and one sensitive...
  • 13
  • 305
  • 0
Báo cáo y học:

Báo cáo y học: "Early Characterization of Toll-like receptors in primary lung epithelial cells: strong impact of the TLR3 ligand poly(I:C) on the regulation of Toll-like receptors, adaptor proteins and inflammatory response" ppt

Báo cáo khoa học

... Sequence 5'-CCCATTCCGCAGTACTCCATT-3' 5'-TTTCCTTGGGCCATTCCA-3' 5'-CAGTTATCACAAGCTCAAAAGTCTCATGGCCA-3' 5'-TGTGAAGAGTGAGTGGTGCAAGT-3' 5'-ATGGCAGCATCATTGTTCTCAT-3' 5'-TGAACTGGACTTCTCCCATTTCCGTCTTTT-3' ... 5'-GCACTTTTATCAATTGGCTTAATCAC-3' 5'-AACGAGTCAGGGTACACACAATATATG-3' 5'-CAATGTCACTATAGCTGGGCCTCCTGCAG-3' 5'-CAGTGCTCTTACCCAGATGGA-3' 5'-TCTGATAATCGATGACAGACTTCA-3' 5'-CTGCCTGTGTTTCAATTCACGAAGCT-3' FP: ... stimulated cells were significantly inhibited by a neutralizing anti-IFN-β antibody indicating an IFN-β dependent mechanism of IP -10 and I- TAC induction by poly( I: C) (Fig 2D) In comparison to poly( I: C) ,...
  • 15
  • 374
  • 0
Báo cáo khoa học: The inhibition of Ras farnesylation leads to an increase in p27Kip1 and G1 cell cycle arrest pdf

Báo cáo khoa học: The inhibition of Ras farnesylation leads to an increase in p27Kip1 and G1 cell cycle arrest pdf

Báo cáo khoa học

... p27Kip1 levels in the cyclin D1/Cdk6 and cyclin D1/Cdk4 complexes, with no inhibitory effect on their kinase activities We evaluated the ability of HR12 to affect p27Kip1 content in the cyclin D1/Cdk6 ... untreated cells However, no change in kinase activity was detected Immunoprecipitation of cyclin D1/Cdk4 and cyclin D1/Cdk6 complexes using anti-(cyclin D1) Igs revealed an HR12-induced increase ... Reuveni et al (Eur J Biochem 270) proteins, which bind to and specifically inhibit Cdk4 and Cdk6 complexes [17 ], and the Kip/Cip inhibitors (p21Cip1, p27Kip1 and p57Kip2) with broader specificity [15 ]...
  • 14
  • 474
  • 0
báo cáo hóa học:

báo cáo hóa học: " Chronic brain inflammation leads to a decline in hippocampal NMDA-R1 receptors" doc

Hóa học - Dầu khí

... involvement in cytotoxicity Proc Natl Acad Sci USA, 19 95, 92: 811 5- 811 9 Minghetti L, Levi G: Induction of prostanoid biosynthesis by bacterial lipopolysaccharide and isoproterenol in rat microglial cultures ... 2004, 1: 12 http://www.jneuroinflammation.com/content /1/ 1 /12 Figure Confocal microscopic images of NMDAR1 receptors within the hippocampus Confocal microscopic images of NMDAR1 receptors within the ... LPS: lipopolysaccharide; MHC II: Class II major histocompatibility complex; 10 11 12 13 14 Competing Interests None declared 15 Authors' Contributions SR and GLW participated in the design of...
  • 9
  • 371
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Early percutaneous dilatational tracheostomy leads to improved outcomes in critically ill medical patients as compared to delayed tracheostomy" doc

Báo cáo khoa học

... including reduced laryngeal irritation, better patient tolerance, enhanced ability to communicate, and easier nursing care [2] It is, however, not without risk and there continues to be considerable ... this determination was made by clinicians and lacked specific objective criteria, making it difficult to determine precisely which patients should be selected for early tracheostomy based on these ... predict The fact that ten of the sixty patients randomized to the late group did not require tracheostomy points out the inherent difficulty in making this prediction In this study, this determination...
  • 2
  • 285
  • 0
Students must write aguide to better writing in coureswork and examinations

Students must write aguide to better writing in coureswork and examinations

Tổng hợp

... underachieve because they pay insufficient attention to improving their ability to communicate their thoughts in writing Effective writing as the basis for success Writing is important in studying ... remember 11 Making good notes 11 Writing helps you to observe 15 Making notes in practical work 16 Writing helps you to think 17 Capturing your thoughts 17 Writing helps you to communicate 18 Improve ... from lectures, tutorials, seminars, practical work, background reading and other sources Problem solving Not thinking things through to a satisfactory conclusion Thinking and creativity Mindless...
  • 441
  • 353
  • 0
Báo cáo y học:

Báo cáo y học: " Pre-treatment mortality and loss-to-follow-up in HIV-1, HIV-2 and HIV-1/HIV-2 dually infected patients eligible for antiretroviral therapy in The Gambia, West Africa" doc

Báo cáo khoa học

... Cotrimoxazole (Septrin) prophylaxis The clinic medical team includes a specialist HIV physician and research clinic physicians with at least four years post qualification experience This clinic ... will contribute to more accurate staging of HIV disease This will be of importance in the realm of intensified efforts at scaling up access to ART when CD4 T cell counting monitoring is limited in ... system that will minimize delays in initiation of ART and help mitigate the clinical, social and economic barriers to accessing ART among eligible HIV infected patients Page of 8 10 Acknowledgements...
  • 8
  • 400
  • 0
Báo cáo y học:

Báo cáo y học: " Lack of adaptation to human tetherin in HIV-1 Group O and P" pot

Báo cáo khoa học

... statistical significance, which may explain its less efficient ability to antagonize tetherin Group M Vpu has been shown to physically interact with human tetherin by co-immunoprecipitation (coIP) ... dynamics and alpha interferon production during Simian immunodeficiency virus infection with a nonpathogenic outcome J Virol 2008, 82: 514 5- 515 2 62 Lim ES, Emerman M: Simian immunodeficiency virus ... the introduction of alanine -18 into the defective chimera, M14O, to create construct M14O-N18A, was sufficient to re-locate the protein from an ER-like distribution to the TGN, and to restore activity...
  • 18
  • 349
  • 0
Báo cáo y học:

Báo cáo y học: " Dendritic cell-mediated HIV-1 transmission to T cells of LAD-1 patients is impaired due to the defect in LFA-1" docx

Báo cáo khoa học

... protein kinase activity [20] Another factor influencing HIV -1 infectivity is the incorporation of host ICAM -1 in budding virions and expression of LFA -1 on target cells [36-40] To critically ... P-selectin glycoprotein ligand -1 stimulates LFA -1- mediated cell binding to ICAM -1 J Immunol 2005, 17 4 :14 24 -14 32 Carman CV, Springer TA: Integrin avidity regulation: are changes in affinity and conformation ... taking place Since there is no strong binding to ICAM -1, signaling through LFA -1 into the T cell (outside -in signaling) is probably not taking place either In healthy individuals, signaling through...
  • 9
  • 355
  • 0
Tài liệu Báo cáo khoa học: Parvalbumin deficiency in fast-twitch muscles leads to increased ‘slow-twitch type’ mitochondria, but does not affect the expression of fiber specific proteins doc

Tài liệu Báo cáo khoa học: Parvalbumin deficiency in fast-twitch muscles leads to increased ‘slow-twitch type’ mitochondria, but does not affect the expression of fiber specific proteins doc

Báo cáo khoa học

... AAG CTC ACT GG GTG AGG GAG ATG CTC AGT GTT GG AGTAACAATTTTCAGTGCTCCAAAC AATATACGGTTCATGGCAATACTGT CTACCCCGGCGCTGGAGTCAAC TCAGATGTTTTGCCACAAAGAGGTGCCTCCT CGA GCT TGC TTT ACA TCA GCC TGT GTC ATC ... P32848 P19 511 P07 310 P 215 50 Myosin light chain Myosin light chain Myosin light chain Parvalbumin F1-ATPase b-subunit Creatine kinase, M chain b-enolase 18 16 14 12 51 41 46 9 41 642 310 305 080 17 1 ... mitochondrial biogenesis of ‘slowtwitch’ mitochondria in TA, resulting in a mitochondrial volume and a biochemical composition as found in slow-twitch muscle Also with respect to ATP content in...
  • 13
  • 578
  • 0
Phân tích các nhân tố ảnh hưởng đến sự hài lòng về công việc của nhân viên tại công ty cổ phần in và dịch vụ thừa thiên huế

Phân tích các nhân tố ảnh hưởng đến sự hài lòng về công việc của nhân viên tại công ty cổ phần in và dịch vụ thừa thiên huế

Thạc sĩ - Cao học

... Đồng Đ c i m nhập l i 11 0 11 0 11 0 11 0 11 0 11 0 11 0 Kolmogorov-Smirnov Z 1. 104 ,830 ,389 ,522 1, 020 1, 292 1, 188 ,998 ,948 ,249 ,0 71 ,11 9 N Asymp Sig (2-tailed) ,17 5 ,497 nghiệp c ng vi c (Nguồn: ... Ch c Công ty c phần in dịch vụ Thừa Thiên Huế c ng ty in chuyên ngành, i họ cK in h th c ch c chủ yếu in sách giáo khoa, t i liệu ph c vụ ngành giáo d c - đào tạo ấn phẩm kh c theo nhu c u ... l i cho c u h i: Thế nào? T i sao? C i gì? C c kỹ thuật sử dụng chủ yếu nghiên c u: - Nghiên c u t i liệu: Tham khảo sách báo t i liệu, nghiên c u liên quan th c trư c Việt Nam nư c C c nghiên...
  • 109
  • 503
  • 0
Phân tích các nhân tố ảnh hưởng đến sự hài lòng về công việc của nhân viên tại công ty cổ phần in và dịch vụ Thừa Thiên Huế

Phân tích các nhân tố ảnh hưởng đến sự hài lòng về công việc của nhân viên tại công ty cổ phần in và dịch vụ Thừa Thiên Huế

Kinh tế - Thương mại

... Đồng Đ c i m nhập l i 11 0 11 0 11 0 11 0 11 0 11 0 11 0 Kolmogorov-Smirnov Z 1. 104 ,830 ,389 ,522 1, 020 1, 292 1, 188 ,998 ,948 ,249 ,0 71 ,11 9 N Asymp Sig (2-tailed) ,17 5 ,497 nghiệp c ng vi c (Nguồn: ... Ch c Công ty c phần in dịch vụ Thừa Thiên Huế c ng ty in chuyên ngành, i họ cK in h th c ch c chủ yếu in sách giáo khoa, t i liệu ph c vụ ngành giáo d c - đào tạo ấn phẩm kh c theo nhu c u ... l i cho c u h i: Thế nào? T i sao? C i gì? C c kỹ thuật sử dụng chủ yếu nghiên c u: - Nghiên c u t i liệu: Tham khảo sách báo t i liệu, nghiên c u liên quan th c trư c Việt Nam nư c C c nghiên...
  • 109
  • 423
  • 0
THỰC TRẠNG VÀ GIẢI PHÁP VỀ QUẢN LÝ NHÀ NƯỚC TRONG TỔ CHỨC THỰC HIỆN LUẬT KHIẾU NẠI, TỐ CÁO TẠI ĐỊA BÀN THÀNH PHỐ.DOC

THỰC TRẠNG VÀ GIẢI PHÁP VỀ QUẢN LÝ NHÀ NƯỚC TRONG TỔ CHỨC THỰC HIỆN LUẬT KHIẾU NẠI, TỐ CÁO TẠI ĐỊA BÀN THÀNH PHỐ.DOC

Kế toán

... nư c lĩnh v c để tham mưu cho Thủ trưởng c p vi c quản lý gi i khiếu kiện phát sinh gi i đơn thư tồn đọng c p Hiệu l c hiệu vi c gi i khiếu n i, tố c o chưa cao, c vụ vi c có định gi i khiếu ... mặt thiếu quán, thiếu quy định c thể, thiếu c ng khai dân chủ, thiếu c ng Vi c gi i khiếu n i dân c vi c chưa kịp th i, chưa pháp luật từ nảy sinh khiếu kiện tiếp Bên c nh vi c xử lý không c ơng ... i u 17 , 18 , 57 58 Luật Khiếu n i, tố c o vi c cung c p t i liệu chứng cho vi c khiếu tố, tính trung th c n i dung khiếu n i, tố c o vi c chấp hành th c định gi i quan c thẩm quyền chưa nghiêm...
  • 17
  • 756
  • 1
Báo cáo y học:

Báo cáo y học: "Serum cystatin C levels to predict serum concentration of digoxin in Japanese patients

Y học thưởng thức

... therapeutic range, necessitating the routine monitoring of its serum concentration to maximize the therapeutic effects and minimize toxicities [16 -19 ] Since digoxin is mainly eliminated via the kidneys, ... and Creatininase F-DAOS assay with a Dimension RxL (Dade Behring LIMITED), respectively The serum concentrations of digoxin were by Particle Enhanced Turbidimetric Inhibition ImmunoAssay (PETINIA) ... 39:89 10 4 Ichihara K, Itoh Y, Min WK, et al Diagnostic and epidemiological implications of regional differences in serum concentrations of proteins observed in six Asian cities Clin Chem Lab Med 2004;...
  • 5
  • 523
  • 0
Tổ chức kinh doanh M.I.C.E trong khách sạn

Tổ chức kinh doanh M.I.C.E trong khách sạn

Tài liệu khác

... Service Banquet Service Sales & Marketing Cost control Banquet Sales PR Security Business Center Health Club, Spa Housekeeping Room Service Convention Service Kitchen & Stewarding Receiving Cashiering ... visit - POV) tiếp theo: Leisure Regular Group Leisure ad hoc Group Leisure Social Event Leisure Complimentary Leisure Individual Airline Schedule Crew Airline Emergency Crew Airline Emergency ... Slot Machine, Karaoke,…) - C c dòch vụ hỗ trợ: Tours arrangement, Information of the destination, Air Ticket /booking/confirmation, Restaurant/shopping/site seeing recommendation, Service at airport,...
  • 257
  • 2,810
  • 38
Hoàn thiện công tác kế toán NVL, CCDC tại Công ty TNHH nhà nước một thành viên Cơ Khí Quang Trung

Hoàn thiện công tác kế toán NVL, CCDC tại Công ty TNHH nhà nước một thành viên Cơ Khí Quang Trung

Kế toán

... liệu ph i luôn đ c c i tiến hoàn thiện, phát huy c ch c hiệu l c công c , dụng c kế to n n i chung kế to n nguyên liệu, vật liệu c ng c , dụng c n i riêng M c dù vật liệu c ng c , dụng c c ng ... quy c ch kh c Nên vi c phân lo i NVL, CCDC c ch khoa h c cần thiết Tuy nhiên c ng vi c công ty cha đạt đ c hiệu nh nh yêu c u cha lập sổ danh I m vật t để xếp lo i vật liệu dẫn đến khó khăn c ng ... nhân viên c ng ty ph i c gắng nhiều đ c biệt đóng góp c ng t c tổ ch c kế to n Tr c h i nhập kinh tế Qu c tế đ i h i c ng ty ph i ngày hoàn thiện nữa, kh c ph c dần hạn chế tồn 1. 1 Những u i m...
  • 30
  • 441
  • 0
TỔ CHỨC BỘ MÁY KẾ TOÁN VÀ HỆ THỐNG KẾ TOÁN TẠI CÔNG TY CONSTREXIM I.C.C

TỔ CHỨC BỘ MÁY KẾ TOÁN VÀ HỆ THỐNG KẾ TOÁN TẠI CÔNG TY CONSTREXIM I.C.C

Kế toán

... từ to n NHẬT KÝ CHUNG SỔ C I TK 511 , 515 , 711 , 811 , 642, 911 , 4 21 Nhật ký thu tiền, chi tiền Sổ chi tiết TK 511 , 515 , 711 , 811 , 911 , 4 21 Sổ tổng hợp chi tiết TK 511 , 515 , 711 , 811 , 911 , 4 21 Bảng ... KẾ TO N T I C NG TY CONSTREXIM I. C. C 12 2 .1 TỔ CH C BỘ MÁY KẾ TO N T I C NG TY CONSTREXIM I. C. C 12 2.2 TỔ CH C HỆ THỐNG KẾ TO N T I C NG TY CONSTREXIM I. C. C 14 2.2 .1 C c ... PHÁT TRIỂN C A C NG TY CONSTREXIM I. C. C 1. 2 Đ C I M HOẠT ĐỘNG KINH DOANH C A C NG TY CONSTREXIM I. C. C .4 1. 2.2 Đ c i m hoạt động kinh doanh c ng ty Constrexim I. C. C .5 1. 2.3 Đ c i m quy...
  • 31
  • 433
  • 1
bài 12: sơ lược mỹ thuật các dân tộc ít người ở Việt Nam

bài 12: sơ lược mỹ thuật các dân tộc ít người ở Việt Nam

Mỹ thuật

... I V i nét kh i quát dân t c ngư i H i: Nư c Việt Nam c dân t c anh em? Kể tên số dân t c mà em biết Nư c Việt Nam c 54 dân t c anh em, đoàn kết chống gi c ngo i xâm, bảo vệ XD tổ qu c M i ... hàng ngày, lễ ph c, đồ dùng sinh hoạt t i xách, khăn, đòu… H i: Em biết thổ c m? Lo i v i dệt thủ c ng, hoa văn tinh xảo, màu s c h i hoà, hình tượng c ch i u cao Bố c c thường c n xứng, đường ... H i: Em c nhận xét tháp Chăm? Kiến tr c nhiều tầng, gạch c ng Đư c trang trí kh i tường xây Thánh đòa Mỹ Sơn (Quảng Nam) UNESCO c ng nhận di sản văn hoá gi i b i u kh c Chăm H i: T i n i i u...
  • 30
  • 516
  • 0

Xem thêm