poly i c generate the highest frequency of e7 specific cd8 t cells
Báo cáo y học: "Early Characterization of Toll-like receptors in primary lung epithelial cells: strong impact of the TLR3 ligand poly(I:C) on the regulation of Toll-like receptors, adaptor proteins and inflammatory response" ppt
... 5'-TGAACTGGACTTCTCCCATTTCCGTCTTTT-3' 5'-CCTGGTTTGTTAATTGGATTAACGA-3' 5'-GAGGTGGAGTGTTGCAAAGGTAGT-3' 5'-CCCATACCAACATCCCTGAGCTGTCAA-3' 5'-AGCTCTGCCTTCACTACAGAGACTT-3' 5'-GCTTTTATGGAAACCTTCATGGA-3' ... 5'-CCCGGTGTGGCCATTGCTGC-3' 5'-GCACTTTTATCAATTGGCTTAATCAC-3' 5'-AACGAGTCAGGGTACACACAATATATG-3' 5'-CAATGTCACTATAGCTGGGCCTCCTGCAG-3' 5'-CAGTGCTCTTACCCAGATGGA-3' 5'-TCTGATAATCGATGACAGACTTCA-3' 5'-CTGCCTGTGTTTCAATTCACGAAGCT-3' ... (TP) TRAM (FP) TRAM (RP) TRAM (TP) Sequence 5'-CCCATTCCGCAGTACTCCATT-3' 5'-TTTCCTTGGGCCATTCCA-3' 5'-CAGTTATCACAAGCTCAAAAGTCTCATGGCCA-3' 5'-TGTGAAGAGTGAGTGGTGCAAGT-3' 5'-ATGGCAGCATCATTGTTCTCAT-3'...
- 15
- 374
- 0
báo cáo hóa học:" Generation in vivo of peptide-specific cytotoxic T cells and presence of regulatory T cells during vaccination with hTERT (class I and II) peptide-pulsed DCs" pot
... within individual patients, rather than patient groups Maintaining the levels of TAAg -specific CD8+ T cells in the circulation is the summation of the capacity to generate them and their possible ... numbers of hTERT -specific CD8+ T cells in the circulation of cancer patients[75] However, enhancement of hTERT -specific CD8+ T cells in the circulation, following vaccination in our study were substantially ... Generated T Cells T2 -cytotoxicity Cumulative cytotoxicity results for all patient samples show that after two cycles of vaccination (the time point associated with the maximal tetramer + CD8+ response,...
- 23
- 439
- 0
Báo cáo y học: "Defining the chromatin signature of inducible genes in T cells" pps
... genomic regions through their interaction with transcription factors that recognize their cognate DNA binding sites (reviewed in [1]) The components of the Pol II initiation com- Volume 10, Issue ... activities, most likely brought about by the induction of inducible transcription factors that more efficiently recruit and activate Pol II Many inducible genes in T cells are controlled by inducible ... correlation, complete linkage clustering and viewed with TreeView (Stanford) Abbreviations ChIP: chromatin immunoprecipitation; ChIP-on-chip: ChIP combined with microarray technology; ChIP-qPCR: ChIP...
- 18
- 641
- 0
Báo cáo khoa học: "Hypertrophic cardiomyopathy in young Maine Coon cats caused by the p.A31P cMyBP-C mutation - the clinical significance of having the mutation" ppsx
... thorough echocardiographic assessment of several imaging planes of the heart with follow-ups Genetic testing is currently of limited utility, as the clinical significance of being a mutation carrier ... primers Statistics The Chi-square test (c2 ) was used to evaluate if the genotype distribution was in Hardy-Weinberg equilibrium, a P-value < 0.05 indicated significance The clinical significance ... the mutation indicating that even though there may not be overt evidence of fHCM there is evidence of occult fHCM in these cats [10] If occult disease is taken into consideration then an autosomal...
- 11
- 328
- 0
Báo cáo y học: "PKC and PKA Phosphorylation Affect the Subcellular Localization of Claudin-1 in Melanoma Cells"
... F:5'-ctttgctgttcctgtccccgaaaagacacctcttacccaacacca-3' R:5'-tggtgttgggtaagaggtgtcttttcggggacaggaacagcaaag-3' F:5'-ttcctgtccccgaaaaacagactcttacccaacaccaagg-3' R:5'-ccttggtgttgggtaagagtctgtttttcggggacaggaa-3' ... R:5'-ccttggtgttgggtaagagtctgtttttcggggacaggaa-3' F:5'-actttgctgttcctgtccccgaaaagacgactcttacccaacaccaaggccc-3' R:5'-gggccttggtgttgggtaagagtcgtcttttcggggacaggaacagcaaagt-3' F:5'-aaaacaacctcttacccaacaccagacccctatccaaaacctgca-3' ... A589G_G590A_G59 1C F:5'-gccccagtggaggatttacgcatatgccggcgaca-3' R:5'-tgtcgccggcatatgcgtaaatcctccactggggc-3' F:5'-ccagtgcaaagtctttgacgacttgctgaatctgagcagc-3' R:5'-gctgctcagattcagcaagtcgtcaaagactttgcactgg-3'...
- 9
- 592
- 0
Báo cáo hóa học: " Viable chimaeric viruses confirm the biological importance of sequence specific maize streak virus movement protein and coat protein interactions" pdf
... degree of chlorosis it elicits in infected tissues, but not with respect to infection efficiency or chlorotic area Similarly, exchanging cp alone was insufficient to maintain high infection rates ... cv Jubilee (a sweetcorn) to confirm that the NcoI mutation did not affect either infectivity or symptomatology in this host Both NcoI mutants were indistinguishable from their wild-type counterparts ... via the BCTV -specific leafhopper vector Circulifer renellus (Baker), thereby demonstrating that insect vector specificity for geminiviruses is determined by the coat protein Similarly, Liu et...
- 11
- 357
- 0
Báo cáo y học: "Expression of the inflammatory chemokines CCL5, CCL3 and CXCL10 in juvenile idiopathic arthritis, and demonstration of CCL5 production by an atypical subset of CD8+ T cells" pps
... CCATGAAGGTCTCCGCGGCAC, reverse CCTAGCTCATCTCCAAAGAG; CCL3, forward ATGCAGGTCTCCACTGCTGC, reverse TCAGGCACTCAGCTCCAGGTC; CXCL10, forward AAGGATGGACCACACAGAGG, reverse ACCCTTGGAAGATGGGAAAG Control primers ... synovial fluid T cells This showed a significant increase in the CCL5 positive cells within this CD8+ CD28+ population in the synovial T cells compared to PB (Figure 5c) In addition, these CD28+ CCL5+ ... Research & Therapy Vol No Pharoah et al Table Characteristics of the patients with juvenile idiopathic arthritis included in this study Characteristic Disease subtype Persistent oligoarticular...
- 11
- 508
- 0
Báo cáo y học: "Indoleamine 2,3-dioxygenase-expressing dendritic cells are involved in the generation of CD4+CD25+ regulatory T cells in Peyer''''s patches in an orally tolerized, collagen-induced arthritis mouse model" ppt
... CII -specific T cells DCs from the tolerized mice inhibited the proliferation of CII -specific T cells and inflammatory cytokine production compared with DCs from CIA mice, and these suppressive ... were cocultured with CII-reactive CD4+ T cells and irradiated APCs from CIA mice for days in the presence of CII The CD4+CD25+ T cells induced by CD1 1c+ DCs inhibited the proliferative response of ... 101 cpm, P < 0.05) Without CII stimulation, 1-MT had no significant effect on T- cell proliferation in either group To investigate the effect of IDO on the suppression of antigenspecific T cells...
- 10
- 473
- 0
Báo cáo y học: " The intracellular detection of MIP-1beta enhances the capacity to detect IFN-gamma mediated HIV-1-specific CD8 T-cell responses in a flow cytometric setting pro" ppsx
... positive IFN-γ+ MIP-1β+ T- cells could represent an interesting option to increase the sensitivity of the ICS assay in the detection of IFN-γ mediated HIV-1 -specific responses In order to compare ... that in turn increases the sensitivity of the assay It is unlikely that the increased sensitivity of the IFN-γ+ MIP-1β+ data evaluation is due to false positive detections, since simultaneous unspecific ... effective HIV-1 vaccine that would be crucial, together with antiretroviral therapy, to limit and possibly stop the worldwide AIDS pandemic Several candidate HIV-1 vaccines that aim to stimulate...
- 13
- 379
- 0
Báo cáo y học: " In situ detection of Gag-specific CD8+ cells in the GI tract of SIV infected Rhesus macaques" pptx
... these cells in eliminating and controlling viral replication The availability of a sensitive and specific technique for in situ localization of virus specific CD8 + T cells in archived samples will ... or within the B cell follicle, to understand both the immunological interactions between the different cells (CD8+ T cells, CD4+ T cells, B cells and follicular dentritic cells) within this compartment ... the colon are the port of entry for sexual transmission of HIV/SIV it is most likely important to have HIV- or SIV- specific CD8+ T cells in these locations to have the potential to control the...
- 14
- 206
- 0
THE REGULATORY ROLE OF MATRIX METALLOPROTEINASES IN T CELL ACTIVATION
... switch” due to its interaction with a Zn2+ ion in the catalytic site The catalytic domain contains the active site, is ~160 residues and contains a Zn2+ binding motif of the conserved sequence ... tested, COL-3, a chemically modified tetracycline and 1,10 Phenanthroline, a heterocyclic broad spectrum inhibitor of MMP activity COL-3 is a synthetic inhibitor that lacks antibiotic activity but ... allow the migration of mesenchymal cells from the interstitium into the intraluminal compartment This is a major characteristic of IPF and is associated with the recruitment of inflammatory cells, ...
- 202
- 322
- 0
The mechanistic studies of the anticancer potential of artesunate in human cancer cells
... and dihydroartemisinin exhibits toxicity to Ehrlich ascites tumor (EAT) cells (Woerdenbag et al., 1993) At present, there is extensive evidence suggesting the anti-cancer function of artemisinins, ... clears intracytoplasmic aggregation-prone proteins Importantly, subsequent studies further support this notion, based on the evidence that activation of the autophagic process facilitates the clearance ... UVRAG interacts with hVps34 complex to upregulate the maturation of autophagosomes via stimulation of RAB7 GTPase activity while Rubicon interacts with UVRAG with the opposite function (Liang et...
- 171
- 599
- 0
The role of CD8 t cells in the differentiation of TNF iNOS producing dendritic cells and TH1 responses
... subsets Just like the Th1/Th2 classification of CD4 T cells, activated CD8 T cells can also be broadly classified into Tc1 or Tc2 cells upon activation by stimuli based on their cytokine expression ... involve specific cell-cell interactions, studies have shown that the activation and suppression of other immune cells in the nearby vicinity can also occur without physical interaction Of note, such ... types of lymphocytes T cells provide important cell mediated immunity by participating in the cytolysis of infected cells through the recognition of antigen presented on MHC class I They so through...
- 279
- 365
- 0
The role of interferon gamma in regulating antigen specific CD8 t cell responses in a mouse model of influenza
... the CD8+ T cell response is crucial to viral clearance, the quantity of virus -specific cells generated is equally important in determining the outcome of infection Tetramer staining of CD8+ T cells ... expressing cells HAspecific antibodies form a solid correlate of protection against influenza provided that they match the virus causing the infection In contrast to the antibodies targeted to the ... spike-like glycoproteins on the surface of the virus HA is a lectin that mediates the binding of the virus to target cells and facilitates the entry of the virus into the target cell The proteolytic...
- 263
- 427
- 0
Claudin 1 is the direct target of RUNX3 in gastric epithelial cells
... which stains mucus localized on the luminal surface, a characteristic of mucous neck cells, indicating that they retain the phenotype of relatively undifferentiated gastric epithelial cells (Fig ... junction proteins that function in the sealing of the TJ (142) The crucial task of claudins in the TJs was highlighted by the following evidence Firstly, claudin-1 co-localizes with occludin in ... (PEBP2)α/core binding factor (CBF)α of the Runt domain transcription factors The α subunit heterodimerizes with the β subunits (PEBP2β/CBFβ) to form the heterodimeric transcription factor, initially...
- 146
- 283
- 0
The accessory roles of lipopolysaccharide activated murine b cells in t cell polarization
... condition rich in normal bacterial flora Chapter Introduction 29 interacts with and modulates the innate immune system, priming it to the Th1 direction and maintaining the clinical balance of Th1 ... cytokines defines specific CD4+ T cell subsets, and Chapter Introduction 22 determines their effector functions The influence of cytokines in the differentiation of CD4+ T cell subsets and the ... studies have indicated that natural and adaptive subsets of Treg cells differ in their mechanism of action aTreg mediates the inhibitory activities by producing immunosuppressive cytokines such...
- 250
- 384
- 0
Studies of the anticancer potential of andrographolide in human cancer cells
... Andro-sensitized apoptosis in cancer cells In addition to the sensitization effect of Andro and TRAIL, I also investigated the synergistic effect of Andro on the anticancer activities of doxorubicin, ... transcriptionindependent apoptotic activity of p53 to the intrinsic mitochondrial apoptotic pathway More importantly, two detailed mechanisms have been described according to specific location of ... (2009) Inhibition of constitutive STAT3 activity by Andrographolide enhances chemo-sensitivity of cancer cells to doxorubicin (Manuscript in preparation) Presentation at scientific conferences:...
- 201
- 280
- 0
Electrophysiological study to explore the functional consequences of ng expression on neuroblastoma cells (n2a)
... potentiation, and pseudosubstrate inhibitors or highaffinity substrates of CaMKII or PKC blocked Ca2+/CaM-induced potentiation, indicating the requirement of CaMKII and PKC activities in synaptic potentiation ... level of activated CaMKII accompanied the deficits In addition, hippocampal slices of Ng mutant mice displayed a reduced ability to generate activated CaMKII after stimulation of protein phosphorylation ... ability to generate activated CaMKII after phosphorylation and oxidation,indicating a central role of Ng in the regulation of CaMKII activity By its Ca2+-sensitive CaM-binding feature, and through...
- 117
- 361
- 0
báo cáo hóa học:" In vitro generation of cytotoxic and regulatory T cells by fusions of human dendritic cells and hepatocellular carcinoma cells" docx
... http://www.translational-medicine.com/content/6/1/51 Figure The ability of vaccination with autologous FCs to stimulate T cells The ability of vaccination with autologous FCs to stimulate T cells ... differentiate into CTL with lytic activity against the HCC cells (Figure 3A and 3B) After hr coculture of the HCC cells with healthy donor's T cells stimulated by unirradiated DCs/allo-HCC, the ... CTL by vaccination with autologous FCs We next examined whether fusion cell vaccination could augment the induction of HCC cells -specific CTL in the patient Before vaccination, coculture of nonadherent...
- 19
- 459
- 0
Báo cáo hóa học: " Decreased level of recent thymic emigrants in CD4+ and CD8+T cells from CML patients" pdf
... Magnetic Cell sorting technique (Miltenyi Biotec, Bergisch Gladbach, Germany) After CD4+ and CD8+ T cells sorting, the purity was determined by indirect immune fluorescent analysis The positive cells ... Quantitative detection of sjTRECs can be applied for direct measurement of thymic output and proliferative history of T cells [6] Over the last decade the technique was used to evaluate T- cell immune ... reference The RAG2 was cloned first in the T- A acceptor site and subsequently the sjTREC was cloned in to the EcoRV restriction site of the TOPO TA Vector (Invitrogen, Groning, The Netherlands)...
- 8
- 367
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25