poly i c demonstrate enhanced antitumor effects and prolonged survival
Báo cáo y học: "Early Characterization of Toll-like receptors in primary lung epithelial cells: strong impact of the TLR3 ligand poly(I:C) on the regulation of Toll-like receptors, adaptor proteins and inflammatory response" ppt
... Sequence 5'-CCCATTCCGCAGTACTCCATT-3' 5'-TTTCCTTGGGCCATTCCA-3' 5'-CAGTTATCACAAGCTCAAAAGTCTCATGGCCA-3' 5'-TGTGAAGAGTGAGTGGTGCAAGT-3' 5'-ATGGCAGCATCATTGTTCTCAT-3' 5'-TGAACTGGACTTCTCCCATTTCCGTCTTTT-3' ... stimulated cells were significantly inhibited by a neutralizing anti-IFN-β antibody indicating an IFN-β dependent mechanism of IP-10 and I- TAC induction by poly( I: C) (Fig 2D) In comparison to poly( I: C) , ... 5'-GCACTTTTATCAATTGGCTTAATCAC-3' 5'-AACGAGTCAGGGTACACACAATATATG-3' 5'-CAATGTCACTATAGCTGGGCCTCCTGCAG-3' 5'-CAGTGCTCTTACCCAGATGGA-3' 5'-TCTGATAATCGATGACAGACTTCA-3' 5'-CTGCCTGTGTTTCAATTCACGAAGCT-3' FP:...
- 15
- 374
- 0
Báo cáo sinh học: "Gene therapy with tumor-specific promoter mediated suicide gene plus IL-12 gene enhanced tumor inhibition and prolonged host survival in a murine model of Lewis lung carcinoma" pptx
... proliferation in LLC tumors Treated mice were sacrificed 24 hours after last IAA administration Tumor sections were determined by immunohistochemical staining using specific antibodies against CD4, CD8, ... antigen presentation through its necrotic and apoptotic effects The addition of adenoviral vector-delivered locally active IL12 could potentially maximize the infiltration of specific immune cells ... tumor-specific combined gene therapy using Herpes simplex virus thymidine/ganciclovir system and murine interleukin-12 induces effective antitumor activity against medullary thyroid carcinoma Cancer Gene...
- 10
- 696
- 0
báo cáo hóa học:" Gene therapy with tumor-specific promoter mediated suicide gene plus IL-12 gene enhanced tumor inhibition and prolonged host survival in a murine model of Lewis lung carcinoma" doc
... proliferation in LLC tumors Treated mice were sacrificed 24 hours after last IAA administration Tumor sections were determined by immunohistochemical staining using specific antibodies against CD4, CD8, ... antigen presentation through its necrotic and apoptotic effects The addition of adenoviral vector-delivered locally active IL12 could potentially maximize the infiltration of specific immune cells ... tumor-specific combined gene therapy using Herpes simplex virus thymidine/ganciclovir system and murine interleukin-12 induces effective antitumor activity against medullary thyroid carcinoma Cancer Gene...
- 10
- 485
- 0
Báo cáo y học: " Increased APOBEC3G and APOBEC3F expression is associated with low viral load and prolonged survival in simian immunodeficiency virus infected rhesus monkeys" ppt
... antibodies: anti-CD3 Alexa 700 (BD Biosciences); anti-CD4 Alexa 405 (BD Biosciences), antiCD14 PerCP Cy5.5 (BD Biosciences), anti-CD20 PECy (BD Biosciences) and anti-CD45 FITC (Mitenyi Biotec) ... protein in LTNP than uninfected animals Additional file 3: Major clinical and pathological findings in animals with AIDS Table listing major clinical and pathological findings in individual animals ... incurable diarrhoea, Pneumocystis jirovecii infection or neurological dysfunction as judged from clinical as well as necropsy and histopathological findings, which were available for each macaque...
- 17
- 242
- 0
Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf
... RTnI1F and RTnI116R (5¢-GAGCATGGCGGGAT CCTACATGCGCAC-3¢) and RTnI96F (5¢-GCTGGAGG CCATGGACCAGAAGC-3¢) and RTnI181R, respectively (BamHI ⁄ NcoI sites and termination ⁄ initiation codons are indicated ... TAGC-3¢), ATnI1F and ATnI128R (5¢-GTTCCGGATC CTATCTTCTGGCTTCC-3¢), ATnI130F (5¢-GCCAGAA CCATGGCGGAGGAAC-3¢) and ATnI292R, ATnI130F and ATnI252R (5¢-CAAGTTTGGGATCCTATTTGTTAA CTTTTC-3¢), and ATnI232F ... N-domain and the regulatory TnC-binding site [16] This interaction induces the dissociation of the inhibitory region, which is adjacent to the regulatory TnC-binding site, from actin, resulting in...
- 12
- 514
- 0
Function of Soils for Hum a n Societies and the Environment .The G e o l o g i c a l Society of L ppt
... lithogenic and anthropogenic contents by pedogenetic processes, and implications for ecological risk assessment 63 BA~UELOS, G S & LIN, Z.-O Reuse of agricultural drainage water in central California: ... societies' publications at a discount The Society's online bookshop (accessible from www.geolsoc.org.uk) offers secure book purchasing with your credit or debit card To find out about joining ... Society and benefiting from substantial discounts on publications of GSL and other societies worldwide, consult www.geolsoc.org.uk, or contact the Fellowship Department at: The Geological Society,...
- 5
- 287
- 0
Báo cáo khoa học: "Immunomodulatory and antitumor effects in vivo by the cytoplasmic fraction of Lactobacillus casei and Bifidobacterium longum" pot
... 5) Discussion To examine direct antiproliferative effect of cytoplasmic fraction of L acidophilus, L casei and B longum, we conducted cytotoxicity assay on colon cancer, gastric cancer, and acute ... S, Ishibashi N, Reddy BS Bifidobacterium longum, a lactic acidproducing intestinal baterium, inhibits colon cancer and modulates the intestinal biomarkers of colon carcinogenesis Carcinogenesis ... researchers with the direct intraperitoneal injection of L casei 9018 against the sarcoma-180 [19,27] For the antitumor activity of LABs in vivo, the increased specific tumor immunity in probiotic...
- 8
- 645
- 0
Báo cáo y học: " Novel multi-component nanopharmaceuticals derived from poly(ethylene) glycol, retro-inverso-Tat nonapeptide and saquinavir demonstrate combined anti-HIV effect" potx
... interaction with co-receptor CXCR4 and/ or on HIV-1 transcriptional activation, either of which might be synergistic with SQV inhibition of HIV protease Discussion While recent advances in anti-AIDS ... HIV and general toxicity studies.MJL: Participated in study and conjugate design and critically reviewing manuscript.ABR: Participated in study design and supervised HIV and toxicity studies and ... 2,2'Figure in CH of ; (iii) TFA/CH2Cl2 (1:1); R .I. CK-Tat9 in Fmoc-Cys(S-Trt)-COOH in CH Cl2 with DIPC/DMAP; (ii) 20% Dithiodipyridine 2Cl2 Tat-SQV bioconjugates (iv) equivalents DMSO piperidine...
- 15
- 277
- 0
Báo cáo y học: " Effects of the K65R and K65R/M184V reverse transcriptase mutations in subtype C HIV on enzyme function and drug resistance" pps
... for clinical treatment of HIV-1 infection: zidovudine (ZDV), stavudine (d4T), didanosine (ddI), lamivudine (3TC), zalcitabine (ddC), abacavir (ABC), emtricitabine (FTC) and tenofovir disoproxil ... HIV-1 RTs Purification, determination of specific activity and TFV susceptibility of recombinant subtype C and B HIV-1 RTs (A) Coomassie-Brilliant Blue staining of purified heterodimer RTs after ... constructed by Pst IBgl II digestion of the 1.4 kb PCR amplification product with primers CLTRF 5'-GGAAGGGTTAATTTACTCTAAGAAAAGGC-3' and CLTRPstIR 5'CTATCCCATTCTGCAGCCTCCTCA-3' and MJ4 DNA template;...
- 11
- 255
- 0
Báo cáo y học: "Anatomic and functional leg-length inequality: A review and recommendation for clinical decision-making. Part I, anatomic leg-length inequality: prevalence, magnitude, effects and clinical significance" pdf
... difficult and controversial question is, what is the clinical significance of LLI, and at what magnitude? How much anatomic LLI is clinically significant? Mannello remarked that the clinical significance ... exist, cm of LLD [leg length discrepancy] can be characterized as a minimum LLD, which should be treated in the clinical practice" [60] This estimation of clinical significance dovetails nicely ... range of clinical significance It has been presumed that anatomic LLI, because of its effects on structure, causes muscular hypertonicity and changes in strength and/ or coordination [28] Mincer et...
- 10
- 283
- 0
Báo cáo y học: "In vitro and in vivo antitumor effects of acetylshikonin isolated from Arnebia euchroma (Royle) Johnst (Ruanzicao) cell suspension cultures" pps
... MW: 330.3 CAS#: 24502-78-1 C1 6H16O5 MW:288.3 CAS#: 517-89-5 Figure Chemical structures of acetylshikonin (I) and shikonin (II) Chemical structures of acetylshikonin (I) and shikonin (II) cells Natural ... inducing apoptosis, acetylshikonin may also inhibit DNA topoisomerase, reduce carcinogenesis and possess antimitogenic and angiogenic actions [16,17] As a possible wide spectrum agent combating cancer ... promyelocytic leukemia cell line; IC50: 50% inhibitory concentrations; IOD: integrated optical density; LLC: Lewis lung carcinoma; MCF-7: human breast adenocarcinoma cell line MCF-7; MRP1: multi-drug...
- 7
- 258
- 0
ELUCIDATING THE ROLE OF REDOX EFFECTS AND THE KU80 C-TERMINAL REGION IN THE REGULATION OF THE HUMAN DNA REPAIR PROTEIN KU
... Primer name Sequence (5'→3') Sense ATACCGTCCCACCATCGGGC Antisense GAATTCCTAAGCAGTCACTTGATCCTTTT 30A CCCCTATCCTTTCCGCGTCCTTACTTCCCC 3 0C GGGGAAGTAAGGACGCGGAAAGGATAGGGG 12 Following incubation, virus ... structural changes under control, conditions as well as oxidized and re20 reduced conditions Oxidized conditions were achieved by incubating Ku for 15 on ice in mM diamide Re-reduced conditions ... the intensity of the band, which is indicative of a relatively specific interaction between 36 Figure 11 Ku70/80 C interaction with Ku80CTR in PICUP assay Reactions were prepared in the presence...
- 76
- 440
- 0
Automotive mechanics (volume i)(part 6, chapter36) effects and applications of electric currents
... switch x Electromagnetic induction Electricity can be induced into a conductor by means of magnetism This is referred to as electromagnetic induction This is an important principle as it applies ... Its lines of force cut the wires of the pickup coil and induce the voltage signal in them Induction coil An induction coil, such as the ignition coil of an engine ignition system, has two windings ... electricity (electromagnetism) was discussed Electromagnetic induction is the reverse of this, with magnetism being used to produce electricity The principle of electromagnetic induction is summarised...
- 16
- 319
- 0
Báo cáo y học: "Lifetime health effects and medical costs of integrated stroke services - a non-randomized controlled cluster-trial based life table approach"
... http://www.resource-allocation.com/content/8/1/21 probabilities; (ii) number of patients in each disability category and all events (i. e., transitions); (iii) average survival time/life expectancy; (iv) quality-adjusted ... transition model combining population projections and existing data on stroke epidemiology Their projections indicated that the aging of the population and the increase in cardiovascular survival ... space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution Submit...
- 10
- 568
- 0
i C.ty Thương mại - Dịch vụ Nhựa
... định riêng c ng vi c bu c họ ph i chịu trách nhiệm c ng vi c Đây i u mà C ng ty c n th c Cần c sách đào tạo b i dỡng cho nhân viên kỹ thuật c ng ty Nâng cao hiệu sử dụng vốn, tổ ch c khai th c ... ngo i giao v i Việt Nam, b i bỏ lệnh c m vận kinh tế mở đờng cho c ng ty Việt Nam thiết lập m i quan hệ thơng m i v i đ i t c n c Việt Nam thành viên th c nhiều tổ ch c kinh tế gi i nh Hiệp h i ... ng i Trong c 40 ng i làm vi c th c công ty C ng t c viên gồm 10 ng i, giáo s, tiến sĩ c trình độ kinh nghiệm cao, tốt nghiệp đ i h c chuyên ngành kỹ thuật Số l i làm vi c bán th i gian Chơng II...
- 22
- 167
- 0
Tổ chức kinh doanh M.I.C.E trong khách sạn
... Service Banquet Service Sales & Marketing Cost control Banquet Sales PR Security Business Center Health Club, Spa Housekeeping Room Service Convention Service Kitchen & Stewarding Receiving Cashiering ... visit - POV) tiếp theo: Leisure Regular Group Leisure ad hoc Group Leisure Social Event Leisure Complimentary Leisure Individual Airline Schedule Crew Airline Emergency Crew Airline Emergency ... trọng C c nhu c u thiết yếu khách MICE khách sạn: - Phòng (accommodation) - Phương tiện ăn uống (food & beverage facilities) - Phương tiện ti c/ h i nghò (Meeting/Conference/Banquet facilities)...
- 257
- 2,810
- 38
C¶i c¸ch Doanh nghiÖp Nhµ níc theo híng Cæ phÇn hoa ë níc ta hiÖn nay
... d i danh nghĩa nhận trách nhiệm v i cam kết t i chung c ng ty C c u tổ ch c giản đơn c ng ty c phần đ i h i c đông ( tổ ch c đ i diện quyền sở hũ t i cao c ng ty , c trách nhiệm b i nhiệm ... , CTCP , hình th c CPH doanh nghiệp c hoạt động liên quan t i vi c đánh giá lựa chọn l i lo i hình tổ ch c khuynh hớng mạnh mẽ c I c ch kinh tế nhằm c đ c u CTCP II CPH DNNN Việt Nam lựa chọn ... doanh nghiệp kinh doanh c hiệu , vừa bảo vệ đ c l i ích c a c đông nhà n c Khi tìm hiểu mô hình DNNN gi i pháp c i c ch DNNN số n c khu v c gi i ta thấy , c n c đ i h i DNNN ph i c 100% vốn...
- 23
- 303
- 0
Hoàn thiện công tác kế toán NVL, CCDC tại Công ty TNHH nhà nước một thành viên Cơ Khí Quang Trung
... đ i h i vi c tổ ch c công t c kế toán vật liệu ph i luôn đ c c i tiến hoàn thiện, phát huy c ch c hiệu l c công c , dụng c kế toán n i chung kế toán nguyên liệu, vật liệu c ng c , dụng c n i ... tre C i Bộ Bộ Bộ Chai Lít Kg VII VIII Vòng bi 8218(LX) Con lăn Con lăn fi89*290 Con lăn fi 89*590 Bulông-Êcu Bulông M6*30 Vòng C i C i C i Bulông M8*60 IX X C i Êcu M12 C i Than Than 6*10*27 Viên ... lo i l i đ c vào tính chất,đ c I m kh c để phân lo i M i lo i vật liệu đ c theo d i chi tiết sổ kế toán Ngo i vi c phân lo i d c th c tốt lập d c sổ danh i m vật liệu, tạo i u kiện thuận lợi...
- 30
- 441
- 0
TỔ CHỨC BỘ MÁY KẾ TOÁN VÀ HỆ THỐNG KẾ TOÁN TẠI CÔNG TY CONSTREXIM I.C.C
... PHÁT TRIỂN C A C NG TY CONSTREXIM I. C. C 1.2 Đ C I M HOẠT ĐỘNG KINH DOANH C A C NG TY CONSTREXIM I. C. C .4 1.2.2 Đ c i m hoạt động kinh doanh c ng ty Constrexim I. C. C .5 1.2.3 Đ c i m quy ... trách nhiệm trư c H i đồng quản trị trư c pháp luật vi c th c quyền nhiệm vụ giao C c Phó giám đ c: ngư i giúp vi c cho Giám đ c, Giám đ c uỷ quyền chịu trách nhiệm số lĩnh v c chuyên môn, chịu ... T I C NG TY CONSTREXIM I. C. C 12 2.1 TỔ CH C BỘ MÁY KẾ TOÁN T I C NG TY CONSTREXIM I. C. C 12 2.2 TỔ CH C HỆ THỐNG KẾ TOÁN T I C NG TY CONSTREXIM I. C. C 14 2.2.1 C c sách...
- 31
- 433
- 1
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25