... population Table gives the percentages and Table gives the means ofthe background characteristics ofthe women stratified into the categories of normal hair (grade and I on Ludwig's scale) and hair ... HRQOL as the dependent variables and AGA, BDI, IGR/QUICKI, marital status and education as independent variables were made The possible interactions of hair status with depression (AGA*BDI) and ... the relevance of an epidemiologic survey, andthe standardized scale used by the same trained nurse as part ofthe clinical examination, which means that inter-rater variation was lacking We used...
... subjective and psychological well-being, meaning, flow and strengths and have developed a range of corresponding measures Based on the outstanding work of authors such as Alan Waterman, Corey ... this journal but we feel the research climate and resources are now supportive of these types of challenges Well-being research has increased substantially over the past decade andthe demand to ... well-being research, many of whom we are fortunate to have on our editorial board Several ofthe major achievements occurring over the past decade were facilitated by the formation of “positive...
... mandate necessitates both an analysis ofthe current standing stock of C as well as a determination, both in time and in space, ofthe C flux between forest vegetation andthe atmosphere Stand ... despite lower than average rainfall (table VI) It appears that GPP was more limited by PAR than precipitation in 1997; soil available water, although at times reduced to 40% available, was adequate ... equations are calculated atthe start ofthe simulation period The empirical estimate of foliage production (if present) is subtracted from the simulated estimate of daily net assimilate, along with an...
... IgM-RF and markers of inflammation Discussion Characteristics of ACPA and IgM-RF were studied in a large group of RA and non-RA patients ACPA status was more stable than IgM-RF status in RA and ... Autoantibody levels in relation to markers of inflammation In RA patients, alow correlation between autoantibodies andthe levels of markers of inflammation (as measured by ESR and CRP) was found ... between August 2003 and August 2007 These patients attended one ofthe outpatient rheumatology clinics ofthe Jan van Breemen Institute in the Amsterdam region ofThe Netherlands Each patient's final...
... insecticidetreated bed nets and targeted chemoprophylaxis in a rural area ofThe Gambia, west Africa A review ofthe epidemiology and control of malaria in The Gambia, west Africa Trans R Soc Trop ... evaluate the effects of high or low birth weight as indicators of nutritional status, we categorized by birth weight above (high) or below (low) the population median, and subjected the data to analyses ... including all the molecular analyses JS participated in the field work; GM and SEM participated in drafting the manuscript All authors read and approved the final manuscript Competing interests The authors...
... reports the results of post hoc analyses ofa 24-week maintenance study of olanzapine LAI [2] examining the potential association between olanzapine LAI dose and several safety and efficacy parameters ... Scale (PANSS) [13] total, positive, and negative scores; time to all-cause discontinuation; rate of overall discontinuation; and rate of discontinuation due to efficacy-related reasons “Efficacy-related ... designs; the collection, analysis and interpretation of data; the writing ofthe report; andthe decision to submit the paper for publication Author details Lilly Research Laboratories, Eli Lilly and...
... Cfi1/Net1 Metaphase Early anaphase Late anaphase Fig The FEAR network andthe MEN control Cdc14 localization The degradation of Pds1 and hence activation of Esp1 marks the onset of anaphase Esp1 then ... They had previously shown that the key regulator ofthe metaphase–anaphase transition, Separase, a protease that triggers the separation of sister chromatids atthe metaphase–anaphase transition ... orchestrates anaphase events Atthe onset of anaphase, Cdc14 is activated by the FEAR network and controls many aspects of anaphase chromosome movement The protein phosphatase promotes rDNA segregation...
... ligand induced maturation of immature into mature DCs Aggarwal and Pittenger [28] also demonstrated that MSCs cause immature DCs to decrease TNF-α and mature DCs to increase IL-10 secretion Available ... On the other hand, MSCs may also actively participate in initiating AD [3], they have the potential to favour spread of melanoma metastases [4] and, although mostly immune privileged, they may ... KW, MacKenzie TC, Shaaban AF, Radu A, Moseley AM, Deans R, Marshak DR, Flake AW: Human mesenchymal stem cells engraft and demonstrate site-specific differentiation after in utero transplantation...
... demonstrate that both backbone and side conformations are only slightly adjusted on formation ofthe complex [79] The speci®c activity of AAI against insect a- amylases makes it an attractive candidate ... cysteine ata certain position was also suggested to be important Finally, the report ofthe structure of TMA±AAI was accompanied by an explanation ofthe inability of AAI to inhibit PPA [82] Amino-acid ... against mammalian a- amylases or, on the contrary, just against insect a- amylases In the latter case, this provides a highly speci®c potential weapon in plant defence a- AI2, AAI and some wheat inhibitors...
... autoradiography DNA substrate used in this assay is a d15:d21-mer primer/ template The sequences are 5¢-ACTGGAGATCTGC AT- 3¢ and 5¢-TGAAGCATGCAGATCTCCAGT-3¢ Misincorporation assay The four template/primer ... single-stranded 75-mer (3¢-OH ends) The sequence of 75-mer oligonucleotide is 5¢-AGCTACCATGCCT GCACGAAGAGTGCGTATTATGCCTACACTGGA GTACCGGAGCATCGTCGTGACTGGGAAAAC-3¢ [3H]dTTP (10 lM; 10 CiÆmmol)1) and ... in Materials and Methods, the AP site-containing strand was 3¢-end-labeled with [a- 32P]ddATP, annealed to its complementary strand and treated with human AP endonuclease to release a dRP-containing...
... production of AMP from NADH, ATP and FAD (Table 3) Ninety percent ofthe amount of NADH used in our standard NR assay, and 60% ofthe amount of ATP in a GS assay, was converted into AMP within 10 at ... concentrations of ATP and NADH used in standard GS and NR assays, respectively Data are presented as mean ± SEM Cofactor AMP generated (nmol) % cofactor hydrolysed to AMP None ATP (750 nmol) NADH ... BLAST searches of sequence databases revealed that the band of 70 kDa belonged to the acyl-CoA oxidase protein family, while all ofthe peptides derived from the 47 and 45 kDa bands matched most...
... TGTAAAG TGTAAAG + ) + )95 )1100 )1470 ACACacG ACACttG ACACaaG + + + + ) ) ) ) ) )140 )1100 )1596 )1632 )140 )1100 )1596 )1632 )1874 CAaaTG CAagTG CAaaTG CAaaTG CAaaTG CActTG CAttTG CAgtTG TGAGTCA ... putative signal peptide was constructed as follows The DNA fragment was amplified from GmPDIM cDNA by PCR using the primers 5¢-GACGACGACAAGATGC ACGCACTCTATGGAGC-3¢ and 5¢-GAGGAGAAGC CCGGTTCATAGCTCATCCTTGCTTGAAG-3¢ ... value by that for actin mRNA Fold expression change was calculated as the ratio of mRNA in the samples treated with the stress reagent to that in the untreated sample Data represent the mean ± SD...
... yielded a membranous fraction that pelleted at 40 000 g and was depleted in ATPase polypeptides as judged by SDS ⁄ PAGE analysis (Fig 4A) The absence ofthe ATPase complex indicates that the treatment ... appears that HL and CL treatments cause more extensive damage to the photosynthetic apparatus ofthe mutant plants than does LL treatment Thylakoid membranes were isolated from viridis zb63 plants ... (Eindhoven, the Netherlands) operated at 200 kV accelerating voltage in low- dose mode Images were recorded on Kodak S0163 film ata calibrated magnification of 48 600· Samples were applied to glowdischarged...
... loading rate and sawdust additions on row crop yield and nitrate leaching potentials in Virginia sand and gravel mine reclamation Land Reclamation – A Different Approach In: Proceedings 18th National ... geology, the area belongs to the Bytom Basin In general, its climate can be characterized by an annual average air temperature of 8°C and annual average precipitation of 700 mm The deposits are genetically ... Table Shannon diversity index 'H' and abundance of species (number of species) in plant communities depending on the age and category of areas in the Szczakowa sand mine cast Age of areas (years)...
... main problems; alterations in the availability and status ofwater (dehydration), changes in the spatial organization of biological membranes, anda retardation of biochemical and chemical reactions ... morpho-physiological and growth parameters have been taken into account, as well as the field performance of plants one year after transplantation MATERIALS AND METHODS 2.1 Plant material Seven month-old Eucalyptus ... 0.200) The average value for all ofthe treatments as a whole for the numerical code was 4.88 ± 0.09 The freezing test at –7 ◦ C caused a lot of damage in all ofthe treatments (LD7 > 75%) and there...
... branch level was used to estimate the total leaf area ofthe 26 sampled trees A relationship between the tree basal area, the height to the base ofthe crown andthe total leaf area was established ... suggests initially averaging the gap fraction over a distance of about ten times the length ofa leaf Then, the logarithms of these gap fractions are calculated and averaged over the whole transect ... logarithm ofthe transmission Many authors emphasize the importance of calculating K by averaging the logarithm ofthe transmission rather than the transmission itself [4, 14, 26] The estimate of leaf...
... providing an estimation ofthe potential to form a clot under (patho)physiological conditions The ETP was determined with a Calibrated Automated Thrombogram (CAT) The CAT assays the generation of thrombin ... http://www.aidsrestherapy.com/content/7/1/9 Page of distributed variables Categorical variables were expressed as counts and percentages Coagulation and inflammation markers were compared between patient ... thrombosis and platelet hyperreactivity have been suggested [6-9] Earlier studies focussed on markers of inflammation and coagulation before and after initiation of an ABC-containing regimen No changes...
... potato is often associated with plant maturity, as most resistant plants are also the ones that mature the latest This is a handicap for breeders and growers who aim to get early maturing plants to ... Natural variation of potato allene oxide synthase causes differential levels of jasmonates and pathogen resistance in Arabidopsis Planta 2008, 228(2):293-306 Oberhagemann P, Chatot-Balandras C, ... juxtaposed to the last two digits ofthe publication year, the name ofthe population consensus map or ofthe parental map where the QTL was detected, and an Arabic number that can be followed by a letter...
... regulation of Haspin and Aurora B in animals and yeast [22-24] The functions and localizations of Haspin and Aurora kinases are partly conserved in A thaliana [8,10-12,42], suggesting that functional ... plants Plant Cell 2005, 17(3):836-848 11 Kawabe A, Matsunaga S, Nakagawa K, Kurihara D, Yoneda A, Hasezawa S, Uchiyama S, Fukui K: Characterization ofplant Aurora kinases during mitosis Plant Mol ... that H3S10ph and H3S28ph play a crucial role in cohesion and segregation of sister chromatids [9] In plants, AtAUR3 (Arabidopsis thaliana Aurora kinase3) phosphorylates histone H3 at Ser10 and...