... aspartate (Asp378 in PMA1_NEUCR), several cavities are also seen at the same position in ATC1_RABIT (data not shown) Aside from mutations directed against a small stretch of amino acids adjacent to ... (1994) Computer analysis of bacterial haloacid dehalogenases defines a large superfamily of hydrolases with diverse specificity Application of an iterative approach to database search J Mol Biol ... O Radresa et al (Eur J Biochem 269) Table Topological predictions and average topological modelfor PMA1_NEUCR Comparison with available data on recombinant peptides Predictive algorithms DAS...
... Journal of Mathematical Analysis and Applications, vol 279, no 1, pp 1–21, 2003 21 M Wang, Nonliear Parabolic Equation of Parabolic Type, Science Press, Beijing, China, 1993 22 H Amann, “Dynamic theory ... of linear noncooperative elliptic systems,” Nonlinear ´ ´ Analysis: Theory, Methods & Applications, vol 31, no 5-6, pp 687–699, 1998 14 K Nakashima and Y Yamada, “Positive steady states for prey-predator ... theory of quasilinear parabolic equations—II: reaction-diffusion systems,” Differential and Integral Equations, vol 3, no 1, pp 13–75, 1990 23 H Amann, “Dynamic theory of quasilinear parabolic systems—III:...
... this paper is to build a universal endoreversible steady flow refrigeration cycle model consisting of a constant thermal-capacity heating branch, two constant thermalcapacity cooling branches and ... an infinite heat sink at temperature TH and an infinite heat source at temperature TL is shown in Figure In this T-s diagram, the processes between and , as well as between and are two adiabatic ... branches; the process between and is a heating branch with constant thermal capacity (mass flow rate and specific heat product) Cin ; the processes between and 4, and and are two cooling branches...
... boundary and the boundary variables are treated as P0 / -S primal events The unit models describe both normal and failed behavior and depend on a wide variety of operating parameters and failure ... the causal relationships between variables including normal and failed states The basic elements of a digraph are shown in figure for conduction in a wire Node labels represent deviation variables, ... are a member of the Reliability Proceedings Annual Reliability and Maintainability Society Symposium for 1982 & 1983 Proceedings Annual Reliability and Maintainability Proceedings International...
... calculate the gap matrices Fora given gap matrix, we have to consider all the different ways that its diagram can be assembled using one or two matrices at a time (Again, Feynman diagrams are ... bifurcation diagram in wx (left) with an additional diagram (right) to take into account such a coaxial stacking con®guration The coaxial scoring function depends on both base-pairs (Coaxial diagrams ... bases can also appear inside multiloop diagrams Notice also that the coaxial diagram in equation (11) really corresponds with four new diagrams because once we allow pairing, dangling bases also...
... Information Technology Agreement II … are countries on use of standards and SDoC US and EU have asked for talks leading to a signed agreement APEC World Trade Organizations surveying …… APEC has ... Declaration of Conformity option June 24, 1998 Modelfor Regulatory Reform One Standard feedback Designed once to internationally-accepted global standards Market Surveillance Product sample and ... Standard on what are the requirements and content of a Compliance Folder and a Declaration of Conformity Guidance on market surveillance methods that a government should consider Conform to administrative...
... tRNAUCU and tRNACCU contain nine (AGCAGGAC20aA) and 10 nucleotides (AGCCA17aGGAC20aA), respectively The P horikoshii tRNAArgCCU gene (5¢-GGACCGGTAG CCTAGCCA17aGGAC20aAGGGCGGCGGCCTCCTAAG CCGCAGGTCCGGGGTTCAAATCCCCGCCGGTCCG ... Konno et al However, it was reported that, in the aminoacylation reaction, the kcat and Km values for tRNAArgICG and tRNAArgUCU on the Asn106 fi Ala, Phe109 fi Ala and Gln111 fi Ala mutant proteins ... be unable to form a hydrogen bond, has the same Km value for tRNAArg as that of the wild type and does not affect the affinity of tRNAArg The additional N-terminal domain characteristic for ArgRS...
... Markov Models (Nabende, 2010; Darwish, 2010; Jiampojamarn et al., 2010), Finite State Automata (Noeman and Madkour, 2010) and Bayesian learning (Kahki et al., 2011) to learn transliteration pairs ... algorithm to estimate the counts of multigrams The algorithm has a forward variable α and a backward variable β which are calculated in the standard way (Deligne and Bimbot, 1995) Consider a node r which ... pronounced as “Jaarj” in Hindi Our semi-supervised system learns this as a non-transliteration but it is wrongly annotated as a transliteration in the gold standard Arabic nouns have an article “al” attached...
... but which happen to have common parser actions associated with them Merging and minimising automata Combining the automata for several trees can be achieved using a variety of standard algorithms ... Vijay-Shanker and D Weir 1993 Parsing some constrained grammar formalisms Computational Linguistics, 19(4):591-636 W A Woods 1970 Transition network grammars for natural language analysis Commun A ... positions p and p~ I can be viewed as a four dimensional array, each entry of which contains a set of pairs comprising of a set of nonterminals and an a u t o m a t a state Roughly speaking, an item...
... prepared for analysis as described above Chromatography and mass spectrometry GC-MS was performed at 70 eV on a Finnigan 4500 mass spectrometer using a Galaxy data system and fitted with a Hewlett ... (III), and a- keto diarylpropane (IV) can be explained on the basis of an initial hydrogen abstraction reaction at one of two positions A benzylic radical can be generated at C1, which is resonance ... abstraction from the aromatic ring We also show that a- keto diarylpropane lignin dimeric compounds are degraded by a hydrogen abstraction mechanism to produce benzoic acid derivatives Materials...
... A syntax-based statistical translation model Proceedings of ACL M Collins 2003 Head-driven statistical models for natural language parsing Computational Linguistics Jonathan S Yedidia, William ... IBM model in both language pairs, while it actually uses exactly the same parameters as model The fact that an assumption as simple as “allow permutations, penalize gaps” can produce results almost ... sentence pairs extracted from a corpus of English/Japanese news We used 1000 sentence pairs extracted from pre-aligned data(Utiyama and Isahara, 2003) as a gold standard We segmented all the Japanese...
... this area The Markkula Center for Applied Ethics at Santa Clara University offers a program inviting faculty to apply for assistance with incorporating ethics into any undergraduate course in any ... detrimental to a curriculum integration effort Taking an alternative perspective can better assist in the integration, especially if a faculty member takes a broader view of himself as a part of a larger ... decision-making and management practices; and moving students to greater self-awareness by encouraging personal reflection and values clarification—on individual, organizational, and societal levels Addressing...
... nonlabelled Der p at day 30 displayed an airway inflammation 18 h after treatment, in the same magnitude as in animals challenged with a third HDM aerosol on day 30 (data not shown) The animals ... tracking after intratracheal (i.t.) administration of an airborne allergen relevant for human allergic disease The fate of Der p was followed both at the whole-body level by autoradiography and ... further metabolism of the allergen was altered as a result of the inflammation in the lungs of sensitized animals Up to now there are few data available on the fate of an allergen after inhalation...
... 2007) Many approaches have been proposed for tackling the expert search task within the TREC track Cao et al (2005) propose a two-stage model with a set of extracted metadata Balog et al (2006) ... PageRank (Brin and Page, 1998) P(q|d) can be estimated by using a standard language modelfor IR (Ponte and Croft, 1998) 4.1 Recall that we define an evidence for expert search as a quadruple
... Russian), nearly all features are known, whereas other languages (eg., Asturian, Omagua, Frisian) that have fewer than five feature values known Furthermore, some features are known for many languages ... implication variables by averaging the sampled values after dropping 200 “burn-in” iterations Data Preprocessing and Search After extracting the raw data from the WALS electronic database (Haspelmath ... particular, if fora particular language, we have that f1 is true, then the fact that the implication holds means that f2 must be true On the other hand, if f1 is false fora particular language,...
... 2: Example of a simple grammar lattice All grammars generate a common lexicon for all the grammars) A Grammar Lattice as a Search Space for Grammar Induction a Rule generalization steps a c s ... constraint-based grammars for natural language specifically designed to enable learning from representative examples annotated with semantics We have presented a new grammar learning model and showed ... Discussion A practical advantage of our GARS model is that instead of writing syntactic-semantic grammars by hand (both rules and constraints), we construct just a small annotated treebank - utterances...
... are useful features for probabilistic models, as are grammatical relations and CCG supertags derived from syntactic analysis of clauses Models for the task perform poorly given very basic feature ... number, and punctuation mark in the clause and the word/tag pairs for each element of the clause POS tags provide valuable information about syntactic category as well as certain kinds of shallow ... others have focused on automatic detection of aspectual and temporal data Klavans and Chodorow (1992) laid the foundation for probabilistic verb classification with their interpretation of aspectual...
... corpora in the CHILDES database in five languages (English, German, Italian, Japanese and Russian), we found that approximately 85% are degree-0 and an approximate 10 out of 11 have no internal ... settings and annotations are saved and available the next time the user logs on Finally on the Data Download page, users may download data so that they can use the patterns and derivations offline ... error-driven learners will be trapped if Gcurr generates a language that is a superset of the language generated by Gtarg There is a wealth of learnability literature that addresses local maxima and their...