plans created for a structure model
Báo cáo Y học: Modeling the three-dimensional structure of H+-ATPase of Neurospora crassa Proposal for a proton pathway from the analysis of internal cavities pptx
... aspartate (Asp378 in PMA1_NEUCR), several cavities are also seen at the same position in ATC1_RABIT (data not shown) Aside from mutations directed against a small stretch of amino acids adjacent to ... (1994) Computer analysis of bacterial haloacid dehalogenases defines a large superfamily of hydrolases with diverse specificity Application of an iterative approach to database search J Mol Biol ... O Radresa et al (Eur J Biochem 269) Table Topological predictions and average topological model for PMA1_NEUCR Comparison with available data on recombinant peptides Predictive algorithms DAS...
- 13
- 514
- 0
Báo cáo hóa học: "Research Article Global Behavior for a Diffusive Predator-Prey Model with Stage Structure and Nonlinear" docx
... Journal of Mathematical Analysis and Applications, vol 279, no 1, pp 1–21, 2003 21 M Wang, Nonliear Parabolic Equation of Parabolic Type, Science Press, Beijing, China, 1993 22 H Amann, “Dynamic theory ... of linear noncooperative elliptic systems,” Nonlinear ´ ´ Analysis: Theory, Methods & Applications, vol 31, no 5-6, pp 687–699, 1998 14 K Nakashima and Y Yamada, “Positive steady states for prey-predator ... theory of quasilinear parabolic equations—II: reaction-diffusion systems,” Differential and Integral Equations, vol 3, no 1, pp 13–75, 1990 23 H Amann, “Dynamic theory of quasilinear parabolic systems—III:...
- 19
- 303
- 0
Exergoeconomic performance optimization for a steadyflow endoreversible refrigeration model including six typical cycles
... this paper is to build a universal endoreversible steady flow refrigeration cycle model consisting of a constant thermal-capacity heating branch, two constant thermalcapacity cooling branches and ... an infinite heat sink at temperature TH and an infinite heat source at temperature TL is shown in Figure In this T-s diagram, the processes between and , as well as between and are two adiabatic ... branches; the process between and is a heating branch with constant thermal capacity (mass flow rate and specific heat product) Cin ; the processes between and 4, and and are two cooling branches...
- 10
- 1,256
- 1
Fault tree synthesis from a directed graph model for a power distribution network
... boundary and the boundary variables are treated as P0 / -S primal events The unit models describe both normal and failed behavior and depend on a wide variety of operating parameters and failure ... the causal relationships between variables including normal and failed states The basic elements of a digraph are shown in figure for conduction in a wire Node labels represent deviation variables, ... are a member of the Reliability Proceedings Annual Reliability and Maintainability Society Symposium for 1982 & 1983 Proceedings Annual Reliability and Maintainability Proceedings International...
- 10
- 314
- 0
A dynamic programming algorithm for RNA structure
... calculate the gap matrices For a given gap matrix, we have to consider all the different ways that its diagram can be assembled using one or two matrices at a time (Again, Feynman diagrams are ... bifurcation diagram in wx (left) with an additional diagram (right) to take into account such a coaxial stacking con®guration The coaxial scoring function depends on both base-pairs (Coaxial diagrams ... bases can also appear inside multiloop diagrams Notice also that the coaxial diagram in equation (11) really corresponds with four new diagrams because once we allow pairing, dangling bases also...
- 16
- 688
- 0
Tài liệu A Global Model for Regulatory Reform doc
... Information Technology Agreement II … are countries on use of standards and SDoC US and EU have asked for talks leading to a signed agreement APEC World Trade Organizations surveying …… APEC has ... Declaration of Conformity option June 24, 1998 Model for Regulatory Reform One Standard feedback Designed once to internationally-accepted global standards Market Surveillance Product sample and ... Standard on what are the requirements and content of a Compliance Folder and a Declaration of Conformity Guidance on market surveillance methods that a government should consider Conform to administrative...
- 17
- 417
- 0
Tài liệu Báo cáo khoa học: Modeling of tRNA-assisted mechanism of Arg activation based on a structure of Arg-tRNA synthetase, tRNA, and an ATP analog (ANP) ppt
... tRNAUCU and tRNACCU contain nine (AGCAGGAC20aA) and 10 nucleotides (AGCCA17aGGAC20aA), respectively The P horikoshii tRNAArgCCU gene (5¢-GGACCGGTAG CCTAGCCA17aGGAC20aAGGGCGGCGGCCTCCTAAG CCGCAGGTCCGGGGTTCAAATCCCCGCCGGTCCG ... Konno et al However, it was reported that, in the aminoacylation reaction, the kcat and Km values for tRNAArgICG and tRNAArgUCU on the Asn106 fi Ala, Phe109 fi Ala and Gln111 fi Ala mutant proteins ... be unable to form a hydrogen bond, has the same Km value for tRNAArg as that of the wild type and does not affect the affinity of tRNAArg The additional N-terminal domain characteristic for ArgRS...
- 17
- 512
- 0
Tài liệu Báo cáo khoa học: "A Statistical Model for Unsupervised and Semi-supervised Transliteration Mining" pptx
... Markov Models (Nabende, 2010; Darwish, 2010; Jiampojamarn et al., 2010), Finite State Automata (Noeman and Madkour, 2010) and Bayesian learning (Kahki et al., 2011) to learn transliteration pairs ... algorithm to estimate the counts of multigrams The algorithm has a forward variable α and a backward variable β which are calculated in the standard way (Deligne and Bimbot, 1995) Consider a node r which ... pronounced as “Jaarj” in Hindi Our semi-supervised system learns this as a non-transliteration but it is wrongly annotated as a transliteration in the gold standard Arabic nouns have an article “al” attached...
- 9
- 521
- 0
Tài liệu Báo cáo khoa học: "A structure-sharing parser for lexicalized grammars" pptx
... but which happen to have common parser actions associated with them Merging and minimising automata Combining the automata for several trees can be achieved using a variety of standard algorithms ... Vijay-Shanker and D Weir 1993 Parsing some constrained grammar formalisms Computational Linguistics, 19(4):591-636 W A Woods 1970 Transition network grammars for natural language analysis Commun A ... positions p and p~ I can be viewed as a four dimensional array, each entry of which contains a set of pairs comprising of a set of nonterminals and an a u t o m a t a state Roughly speaking, an item...
- 7
- 406
- 0
Tài liệu Báo cáo khoa học: Cleavage of nonphenolic b-1 diarylpropane lignin model dimers by manganese peroxidase from Phanerochaete chrysosporium Evidence for a hydrogen abstraction mechanism docx
... prepared for analysis as described above Chromatography and mass spectrometry GC-MS was performed at 70 eV on a Finnigan 4500 mass spectrometer using a Galaxy data system and fitted with a Hewlett ... (III), and a- keto diarylpropane (IV) can be explained on the basis of an initial hydrogen abstraction reaction at one of two positions A benzylic radical can be generated at C1, which is resonance ... abstraction from the aromatic ring We also show that a- keto diarylpropane lignin dimeric compounds are degraded by a hydrogen abstraction mechanism to produce benzoic acid derivatives Materials...
- 9
- 496
- 1
Tài liệu Báo cáo khoa học: "An Alignment Algorithm using Belief Propagation and a Structure-Based Distortion Model" pdf
... A syntax-based statistical translation model Proceedings of ACL M Collins 2003 Head-driven statistical models for natural language parsing Computational Linguistics Jonathan S Yedidia, William ... IBM model in both language pairs, while it actually uses exactly the same parameters as model The fact that an assumption as simple as “allow permutations, penalize gaps” can produce results almost ... sentence pairs extracted from a corpus of English/Japanese news We used 1000 sentence pairs extracted from pre-aligned data(Utiyama and Isahara, 2003) as a gold standard We segmented all the Japanese...
- 9
- 455
- 0
Shaping Tomorrow’s Business Leaders: Principles and Practices for a Model Business Ethics Program ppt
... this area The Markkula Center for Applied Ethics at Santa Clara University offers a program inviting faculty to apply for assistance with incorporating ethics into any undergraduate course in any ... detrimental to a curriculum integration effort Taking an alternative perspective can better assist in the integration, especially if a faculty member takes a broader view of himself as a part of a larger ... decision-making and management practices; and moving students to greater self-awareness by encouraging personal reflection and values clarification—on individual, organizational, and societal levels Addressing...
- 23
- 455
- 0
Báo cáo khoa học: A mouse model for in vivo tracking of the major dust mite allergen Der p 2 after inhalation docx
... nonlabelled Der p at day 30 displayed an airway inflammation 18 h after treatment, in the same magnitude as in animals challenged with a third HDM aerosol on day 30 (data not shown) The animals ... tracking after intratracheal (i.t.) administration of an airborne allergen relevant for human allergic disease The fate of Der p was followed both at the whole-body level by autoradiography and ... further metabolism of the allergen was altered as a result of the inflammation in the lungs of sensitized animals Up to now there are few data available on the fate of an allergen after inhalation...
- 12
- 518
- 0
Báo cáo khoa học: "A Probabilistic Model for Fine-Grained Expert Search" pptx
... 2007) Many approaches have been proposed for tackling the expert search task within the TREC track Cao et al (2005) propose a two-stage model with a set of extracted metadata Balog et al (2006) ... PageRank (Brin and Page, 1998) P(q|d) can be estimated by using a standard language model for IR (Ponte and Croft, 1998) 4.1 Recall that we define an evidence for expert search as a quadruple
- 9
- 399
- 0
Báo cáo khoa học: "A Bayesian Model for Discovering Typological Implications" ppt
... Russian), nearly all features are known, whereas other languages (eg., Asturian, Omagua, Frisian) that have fewer than five feature values known Furthermore, some features are known for many languages ... implication variables by averaging the sampled values after dropping 200 “burn-in” iterations Data Preprocessing and Search After extracting the raw data from the WALS electronic database (Haspelmath ... particular, if for a particular language, we have that f1 is true, then the fact that the implication holds means that f2 must be true On the other hand, if f1 is false for a particular language,...
- 8
- 471
- 0
Báo cáo khoa học: "Grammar Approximation by Representative Sublanguage: A New Model for Language Learning" potx
... 2: Example of a simple grammar lattice All grammars generate a common lexicon for all the grammars) A Grammar Lattice as a Search Space for Grammar Induction a Rule generalization steps a c s ... constraint-based grammars for natural language specifically designed to enable learning from representative examples annotated with semantics We have presented a new grammar learning model and showed ... Discussion A practical advantage of our GARS model is that instead of writing syntactic-semantic grammars by hand (both rules and constraints), we construct just a small annotated treebank - utterances...
- 8
- 402
- 0
Báo cáo khoa học: "A Sequencing Model for Situation Entity Classification" pdf
... are useful features for probabilistic models, as are grammatical relations and CCG supertags derived from syntactic analysis of clauses Models for the task perform poorly given very basic feature ... number, and punctuation mark in the clause and the word/tag pairs for each element of the clause POS tags provide valuable information about syntactic category as well as certain kinds of shallow ... others have focused on automatic detection of aspectual and temporal data Klavans and Chodorow (1992) laid the foundation for probabilistic verb classification with their interpretation of aspectual...
- 8
- 458
- 0
Báo cáo khoa học: "A Word-Order Database for Testing Computational Models of Language Acquisition" docx
... corpora in the CHILDES database in five languages (English, German, Italian, Japanese and Russian), we found that approximately 85% are degree-0 and an approximate 10 out of 11 have no internal ... settings and annotations are saved and available the next time the user logs on Finally on the Data Download page, users may download data so that they can use the patterns and derivations offline ... error-driven learners will be trapped if Gcurr generates a language that is a superset of the language generated by Gtarg There is a wealth of learnability literature that addresses local maxima and their...
- 8
- 368
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25