place static content in a zoomable scroll view
Báo cáo khoa học: "Belowground biomass and nutrient content in a 47-year-old Douglas-fir plantation" pptx
... belowground biomass and stand total biomass) based on 200 studies in order to evaluate belowground Ccontent in stands at a national level, but found no discriminating variable, especially stand age The ... was a simple regression line It will be interesting to predict the belowground biomass of a stand using the aerial biomass measurement alone, as it is usually the available information MATERIALS ... (C130) inventory, and from application of biomass and nutrient tables calculated in 1992 The main characteristics of the ecosystem are the following: – – – – – altitude: 750 m; mean annual rainfall:...
- 8
- 229
- 0
Báo cáo y học: "Long-term cyclical in vivo loading increases cartilage proteoglycan content in a spatially specific manner: an infrared microspectroscopic imaging and polarized light microscopy study" ppt
... Arthritis Research & Therapy Vol No Saadat et al Table Table Proteoglycan content in cartilage of cyclically loaded rabbit metacarpophalangeal joints and their contra-lateral controls Collagen ... 1):345-351 40 Maroudas A, Bayliss MT, Uchitel-Kaushansky N, Schneiderman R, Gilav E: Aggrecan turnover in human articular cartilage: use of aspartic acid racemization as a marker of molecular age Arch ... was measured as the mean integrated area of the sugar peak (1,185 - 960 cm-1) in the ROI defined above for each FTIR image [18] The amount of collagen was measured as the mean integrated area...
- 8
- 346
- 0
Báo cáo y học: "Management of chest pain: exploring the views and experiences of chiropractors and medical practitioners in a focus group interview"
... such as endoscopy [66-72] Non-cardiac chest pain, defined most simply as recurrent episodes of unexplained retrosternal pain in patients lacking a cardiac abnormality after a reasonable evaluation, ... chest pain In order for chiropractors to have a role in managing chest pain from the point of entry, they must acquire and demonstrate competence in diagnosing the complaint Chest pain can have a ... chest pain, whether as a main presenting complaint or as a co-morbid condition The prevalence and clinical management, both diagnosis and treatment, of musculoskeletal chest pain in ambulatory...
- 10
- 788
- 0
Using Cooperative Learning to Integrate Thinking and Information Technology in a Content.doc
... pause in computer use, students can analyze what they have learned and done, share information with others, and plan their next steps After using computers, students can again analyze and share ... teachers for information, and instead can work together to find and share knowledge All the same benefits of cooperative learning presented above in the normal classroom apply equally in information ... researched information in the development of setting, character, and plot In addition, essays are evaluated for language use, particularly for one or two grammatical items on which the teacher wanted...
- 9
- 668
- 0
Tài liệu BUSINESS OPPORTUNITIES IN A PLACE doc
... of initial information received by travelers, and in their place- related business decisions After doing so, the marketing task is almost done for a particular case Then, the local and non-local ... firms negotiate contracts and have deals Remember that a weakness of a place is not always disadvantageous; it may be an opportunity under the businessperson’s eye Opportunities are available everywhere; ... Teaching Program 2003-2004 Marketing Places Lecture note Business Opportunities in a Place o Horizontal and vertical linkages to their business line o The general economic conditions with related...
- 2
- 473
- 0
Tài liệu Báo cáo khoa học: "A Multimodal Interface for Access to Content in the Home" pdf
... database These are used in conjunction with a predefined multimodal grammar template and any available corpus training data to build a multimodal understanding model and speech recognition language ... Systems In Proceedings of the 40th ACL pp 376-383 Michael Johnston and Srinivas Bangalore 2005 Finitestate Multimodal Integration and Understanding Journal of Natural Language Engineering 11.2 Cambridge ... differentiate between lack of results due to recognition or understanding problems versus lack of items in the database This has to be balanced against degradation in accuracy resulting from increasing...
- 8
- 585
- 0
SUCCESS FACTORS OF PLACE MARKETING: A STUDY OF PLACE MARKETING PRACTICES IN NORTHERN EUROPE AND THE UNITED STATES doc
... especially at increasing the attractiveness of a place There is no one accepted definition of a brand Relevant areas of study regarding place branding have been urban planning, retail marketing and ... marketing can be also applied to places, and the tools of corporate marketing can be transferred to place marketing Places can also be branded, through creating and communicating a place identity, ... transferred to place marketing” Moreover, the challenge in the global place market has never been greater An additional argument is that places as geographic locations can also be branded (also...
- 274
- 1,785
- 0
small business in paradise, working for yourself in a place you love (2007)
... from planting a vineyard and making wine as an amateur is invaluable.” Making wine is an art form, and takes not only firsthand experience, but an education in viticulture If you don’t have both ... thought about moving to Napa or Sonoma and opening a winery With a bed and breakfast, if nobody shows up I can eat the breakfast and sleep in the room But in a winery, I can drink the wine And that ... “They’re looking for a story,” she says, explaining that customers tend to shy away from big-name wineries and favor instead a small label with an 30 | small business in paradise interesting background...
- 242
- 676
- 0
small business in paradise, working for yourself in a place you love (2007)
... from planting a vineyard and making wine as an amateur is invaluable.” Making wine is an art form, and takes not only firsthand experience, but an education in viticulture If you don’t have both ... thought about moving to Napa or Sonoma and opening a winery With a bed and breakfast, if nobody shows up I can eat the breakfast and sleep in the room But in a winery, I can drink the wine And that ... “They’re looking for a story,” she says, explaining that customers tend to shy away from big-name wineries and favor instead a small label with an 30 | small business in paradise interesting background...
- 242
- 542
- 0
a place to believe in locating medieval landscapes may 2006
... in ways reminiscent of an Anglo-Saxon hall (one at Yeavering, perhaps) as well as a monastery Augustine’s dwelling, as Bede calls it, is a place apart, a place of authority, hierarchy, and masculinity a ... England and Northumbria in particular, see Alan Thacker, ‘‘The Making of a Local Saint,’’ 45–72, and Catherine Cubitt, ‘‘Universal and Local Saints in Anglo-Saxon England,’’ 423–53, in Local Saints ... represent it in language and, every day, to be engaged in it; makes a place there So, unlike a region, a place isn’t something a human being just comes across Human beings make a place by their activity,...
- 283
- 298
- 0
– GED LITERATURE AND THE ARTS, READING PRACTICE QUESTIONS – 61. d. It is ironic that in a place pdf
... regular polygon has sides and angles that are all equal An equiangular polygon has angles that are all equal Angles of a Quadrilateral A quadrilateral is a four-sided polygon Since a quadrilateral ... paragraph that expresses the main idea of that paragraph tragedy a play that presents a character’s fall due to a tragic flaw tragic hero the character in a tragedy who falls from greatness and accepts ... GED has an increased focus on “math in everyday life.” This is emphasized by allowing the use of a calculator on Part I as well as by an increased emphasis on data analysis and statistics As a result,...
- 48
- 435
- 0
Báo cáo hóa học: " Research Article A Fuzzy Color-Based Approach for Understanding Animated Movies Content in the Indexing Task" doc
... (CITIA), which is the organization managing the festival, to compose a numerical animation movie database, soon to be available online for general use (see Animaquid at http://www.annecy.org) Managing ... research has been done in this field, especially in the animated movie domain [6] Many of the existing color characterization methods have focused naturally on the static image indexation task as ... color saturation: “weak colors are predominant,” “saturated colors are predominant,” “there is a saturation contrast” and color warmth: “warm colors are predominant”, “cold colors are predominant”,...
- 17
- 338
- 0
Is Ho Chi Minh city a much better place to live in today ppt
... of transportation, tuition fees accommodation and a variety of private services such as tailoring, hairdressing, renovating, etc here are all much higher than the so-called standard legal income ... just earn enough money to be physical beings, not emotional or spiritual beings Its increasing crime and disorder also makes Ho Chi Minh City a worse place to live in today than ten years ago A number ... ‘native’ citizens’ viewpoint, I strongly disagree with the flattering statement that Ho Chi Minh city is a much better place to live today than 10 years ago Pollution is the first thing that makes...
- 7
- 606
- 0
Báo cáo lâm nghiệp: " Quantification of nutrient content in the aboveground biomass of teak plantation in a tropical dry deciduous forest of Udaipur, Indi" pdf
... Chaturvedi and Singh (1987) in a pine forest, Rawat and Singh (1988) in an oak forest and by Bargali et al (1992), in a Eucalyptus plantation, in Central Himalaya, India Acknowledgements The authors ... Management of Soil, Water and Nutrients in Tropical Plantation Forests Australian Centre for International Agricultural Research (ACIAR), Monograph No 43 Canberra, Canberra Publishers: 571 NARWAL ... aboveground biomass of teak plantation, Udaipur, Rajasthan, India N Component Table Concentration of nutrients (% ± 1.s.e.) in the aboveground biomass of teak plantation, Udaipur, Rajasthan, India 1.79...
- 6
- 353
- 0
Báo cáo lâm nghiệp: "Variation in wood volatile compounds in a mixed oak stand: strong species and spatial differentiation in whisky-lactone content" pptx
... high natural variability of volatiles in oak wood within and between individual trees must be taken into consideration Moreover, experimental practices such as sampling, storage and preparation ... mixed stands of Q petraea and Q robur The sampled stand covers approximately with a total of 286 standing trees It consists of three ecological zones: a small valley, a plateau and a regular intermediate ... the actual values, were used 2.3.3 Spatial analysis We have used the SGS software [11] The spatial structure of continuous quantitative traits can be analysed by applying a distance 315 measure...
- 8
- 312
- 0
báo cáo khoa học: "Genetic variation of g-tocopherol methyltransferase gene contributes to elevated a-tocopherol content in soybean seeds" pdf
... AQGV-GITLS -PVQAKRAND -PVQAQRANA -PVQAQRANA -PVQAQRANS -PVQAKRAND SPVQAQRAQQ -PVQAERANA -PVQAERGNA -PKQAARANA -PVQANRAIA LAAAQSLAHK LAAAQGLDDK LAAAQGLADK LAAAQGLADK LAAAQSLSHK LADAQGLNGK LAAAQGLADK ... to 3’) Forward CAGTGGACTTAAAACCATAAAGGGAGC CCACATACTCTATATCATTCACACGAG Forward TGATTAACAGGGACAGTCGG Reverse b-tubulin CGCCAATCATAGGAGATATTGCATATG Reverse 18S rRNA GAAGCAAGTTTCCAACAGGTCG Reverse ... GCACAATAAATTGGGCCTGA GCGAGTGTTGGGCTAAGTCT Reverse KSC138-23 TAAAGCCGCCTAGCCGATTG Forward TGCAGCAATAATCAATCAAATAGAA Reverse KSC138-22 TTCAATCAAATTTAGCACGTGTATT Forward CGGTCCAGATTTAATTCTTTCACTC...
- 17
- 432
- 0
Báo cáo khoa học: "Bench-to-bedside review: Is there a place for epinephrine in septic shock" pptx
... correlating an increase in MAP with an increase in cardiac index [6] Using epinephrine as a first line agent, Moran et al [7] reported a linear relationship between epinephrine dosage and heart rate, ... does adrenaline have a role as a first-line inotropic agent? Anaesth Intensive Care 1992, 20: 470-474 Moran JL, O’Fathartaigh MS, Peisach AR, Chapman MJ, Leppard P: Epinephrine as an inotropic agent ... current data regarding the splanchnic effects of catecholamine should be considered as pharmacological investigations of a vasoactive agent evaluated by a particular monitoring device The discrepancy...
- 5
- 278
- 0
Báo cáo y học: "A model analysis of static stress in the vestibular membranes" ppsx
... elements have only a single curvature to bear the pressure load Thus assigning a spherical configuration to a particular chamber imputes a lower value to its shape determinant while assigning a cylindrical ... whale [6] Gray makes it a point to indicate that the membranous semicircular canal often fills the bony channel, leaving little in the way of perilymphatic space in most animals Thus the maximal ... estimate of the size determinant by noting that the vestibular membrane structures are contained in a bony analog, the otic capsule, that acts as a physical limit to the relative sizes that may...
- 8
- 366
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25