pl sql loading character data from a bfile into a lob

Tài liệu Module 1: Displaying Data from a Database docx

Tài liệu Module 1: Displaying Data from a Database docx

Ngày tải lên : 11/12/2013, 14:15
... for databases as well When you import the database that you want to use, FrontPage places a copy of the database in your Web 11 12 Module 1: Displaying Data from a Database ! Import a database ... from within a FrontPage-based application, you need to connect to a database using the Database Results Wizard Module 1: Displaying Data from a Database Demonstration: Importing a Database to the ... “Displaying Data from a Database” ! Lab 1.1, “Retrieving Data from a Database” ! Lab 1.2, “Creating a Detail Results Page” Preparation Tasks To prepare for this module, you should: ! Read all...
  • 40
  • 540
  • 0
  1. Công Nghệ Thông Tin
  2. Chứng chỉ quốc tế
Tài liệu Module 1: Displaying Data from a Database ppt

Tài liệu Module 1: Displaying Data from a Database ppt

Ngày tải lên : 21/12/2013, 19:15
... for databases as well When you import the database that you want to use, FrontPage places a copy of the database in your Web 11 12 Module 1: Displaying Data from a Database ! Import a database ... from within a FrontPage-based application, you need to connect to a database using the Database Results Wizard Module 1: Displaying Data from a Database Demonstration: Importing a Database to the ... “Displaying Data from a Database” ! Lab 1.1, “Retrieving Data from a Database” ! Lab 1.2, “Creating a Detail Results Page” Preparation Tasks To prepare for this module, you should: ! Read all...
  • 40
  • 451
  • 0
  1. Công Nghệ Thông Tin
  2. Chứng chỉ quốc tế
Tài liệu Updating a Data Source with Data from a Different Data Source doc

Tài liệu Updating a Data Source with Data from a Different Data Source doc

Ngày tải lên : 21/01/2014, 11:20
... tracks changes made to data by maintaining multiple versions of each row allowing the data to be reconciled later to a data source using a DataAdapter The data source to which the DataSet is reconciled ... destination DataAdapter is called using the DataSet containing the changes as the data object argument; this applies the changes to the destination data source The destination DataSet is then cleared ... { // Create a DataSet of the added, modified, and deleted records DataSet dsDelta = dsSource.GetChanges(DataRowState.Added | DataRowState.Modified | DataRowState.Deleted); if (dsDelta != null)...
  • 4
  • 326
  • 0
  1. Công Nghệ Thông Tin
  2. Kỹ thuật lập trình
Tài liệu Character Animation from a Motion Capture Database pptx

Tài liệu Character Animation from a Motion Capture Database pptx

Ngày tải lên : 21/02/2014, 05:20
... the database to add details and a particular style to an initial keyframed animation Then, a different approach to create a character animation is proposed: the animator starts the animation with ... main goal is to create a character animation semi-automatically, following the same procedure that an animator would manually Animators are trained to use keyframing, and will often build a character ... sequences from a database of motion capture examples using a statistical model created from the captured data Pullen and Bregler [PB02] described a method to enhance an initial keyframed animation...
  • 101
  • 502
  • 0
  1. Văn Hóa - Nghệ Thuật
  2. Mỹ thuật
Phát triển với PL/SQL trong IBM Data Studio 2.2 và Optim Development Studio 2.2 docx

Phát triển với PL/SQL trong IBM Data Studio 2.2 và Optim Development Studio 2.2 docx

Ngày tải lên : 09/03/2014, 03:20
... C:\jdbcDrivers\Oracle\datadirect\lib\base.jar C:\jdbcDrivers\Oracle\datadirect\lib\util.jar C:\jdbcDrivers\Oracle\datadirect\oracle.jar C:\jdbcDrivers\Oracle\datadirect\lib\oracle.jar Các đặc tính: Oracle 10 Danh ... Explorer Data Project Explorer Kéo gói PL/ SQL từ Data Source Explorer vào thư mục PL/ SQL Packages dự án DB2 bạn Data Project Explorer (Nếu Data Source Explorer Data Project Explorer nhìn thấy được, ... PROCEDURE ExampleProcedure; FUNCTION ExampleFunction RETURN INT; END PACKAGE1; Phần thân gói PL/ SQL cài đặt thủ tục hàm này: CREATE OR REPLACE PACKAGE BODY PACKAGE1 AS /* PL/ SQL package body */...
  • 60
  • 304
  • 2
  1. Công Nghệ Thông Tin
  2. Cơ sở dữ liệu
Accuracy of Clinical Signs in the Diagnosis of Pulmonary Tuberculosis: Comparison of Three Reference Standards Using Data from a Tertiary Care Centre in Rwanda doc

Accuracy of Clinical Signs in the Diagnosis of Pulmonary Tuberculosis: Comparison of Three Reference Standards Using Data from a Tertiary Care Centre in Rwanda doc

Ngày tải lên : 22/03/2014, 18:20
... unilateral apical infiltrates, haemoptysis and cavities, and unilateral apical infiltrates and fever This model provided significant better fit to the data than model Model is a three-latent class ... the data It indicates the amount of the relationship between the variables that remains unexplained by a model; the larger the value, the poorer the model fits the data As a rule of thumb, a good ... estimated Se and Spe of disease characteristics with an LCA strategy [17,27,28] In patients for whom results from at least diagnostic TB tests are available, LCA can distinguish two subgroups: “patients...
  • 7
  • 506
  • 0
  1. Y Tế - Sức Khỏe
  2. Sức khỏe giới tính
Phát triển với PL/SQL trong IBM Data Studio 2.2 và Optim Development Studio 2.2 pdf

Phát triển với PL/SQL trong IBM Data Studio 2.2 và Optim Development Studio 2.2 pdf

Ngày tải lên : 07/08/2014, 09:23
... l.jar C:\jdbcDrivers\Oracle\datadirect\lib\or acle.jar Các đặc tính: Oracle 10 Danh mục URL kết nối Oracle 11 TẤT CẢ (ALL) TẤT CẢ (ALL) jdbc:datadirect:oracle://habu.svl jdbc:datadirect:oracle://chex.svl ... PROCEDURE ExampleProcedure; FUNCTION ExampleFunction RETURN INT; END PACKAGE1; Phần thân gói PL/ SQL cài đặt thủ tục hàm này: CREATE OR REPLACE PACKAGE BODY PACKAGE1 AS /* PL/ SQL package body */ ... s a đổi thay trình soạn thảo với thường trình gói PL/ SQL riêng bạn Đặc tả gói PL/ SQL cung cấp chữ ký cho thủ tục hàm: CREATE OR REPLACE PACKAGE PACKAGE1 AS /* PL/ SQL package specification */ PROCEDURE...
  • 104
  • 346
  • 0
  1. Công Nghệ Thông Tin
  2. Cơ sở dữ liệu
Báo cáo y học: " The prevalence of common mental disorders and PTSD in the UK military: using data from a clinical interview-based study" pdf

Báo cáo y học: " The prevalence of common mental disorders and PTSD in the UK military: using data from a clinical interview-based study" pdf

Ngày tải lên : 11/08/2014, 17:20
... Milliken et al (2007) age; percentage for all other variables c UK data weighted to take account of sampling weights d Demographic data are not separately available for those on active duty and those ... study had greater statistical power than envisaged as the final response rate was 76% Analysis All statistical analyses were undertaken using the statistical software package STATA (version 10.0) ... US data are limited in several ways First, although the data relate to the same Iraq deployment, they were collected in different ways The PDHRA data was collected cross-sectionally in 20056 and...
  • 12
  • 469
  • 0
  1. Luận Văn - Báo Cáo
  2. Báo cáo khoa học
báo cáo khoa học: " Detection and validation of single feature polymorphisms using RNA expression data from a rice genome array" pot

báo cáo khoa học: " Detection and validation of single feature polymorphisms using RNA expression data from a rice genome array" pot

Ngày tải lên : 12/08/2014, 03:20
... AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA ... TGAAGTTGAGTTGTCTTGAAGTGGGTCACTATGAAAACTATCAGCTGTCATTATACTTAACTGGGAAAATGCAATGAAGTTATTTTCTGATTTCTCCTGA : 100 I TGAAGTTGAGTTGTCTTGAAGTGGGTCACTATGAAAACTATCAGCTGTCATTATACTTATCTGGGAAAATGCAATGAAGTTATTTTCTGATTTCTCCTGA ... AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : Os s.33510.1.S2 2_at P I F S P I F S GTAGATTTGTAGAGAAACAACCCTGTAAATCCGGTGAT...
  • 10
  • 250
  • 0
  1. Luận Văn - Báo Cáo
  2. Báo cáo khoa học
Báo cáo y học: "Hyperuricemia and the risk for subclinical coronary atherosclerosis - data from a prospective observational cohort study" potx

Báo cáo y học: "Hyperuricemia and the risk for subclinical coronary atherosclerosis - data from a prospective observational cohort study" potx

Ngày tải lên : 12/08/2014, 15:23
... raw data sets and takes responsibility for the integrity of the data and the accuracy of the data analysis Takeda Pharmaceuticals International, Inc did not have access to the raw data, and Takeda ... 114:1761-1791 Tanaka M, Tomiyasu K, Fukui M, Akamabe S, Kobayashi-Takenaka Y, Nakano K, Kadono M, Hasegawa G, Oda Y, Nakamura N: Evaluation of characteristics and degree of remodeling in coronary atherosclerotic ... literature that implicates the vascular injury associated with hyperuricemia - both macrovascular and microvascular [2,22,35] Page of Abbreviations CAC: coronary artery calcification; CAD: coronary...
  • 8
  • 350
  • 0
  1. Luận Văn - Báo Cáo
  2. Báo cáo khoa học
Báo cáo y học: "Health related quality of life in trauma patients. Data from a one-year follow up study compared with the general population" potx

Báo cáo y học: "Health related quality of life in trauma patients. Data from a one-year follow up study compared with the general population" potx

Ngày tải lên : 13/08/2014, 23:20
... the data, performing the data analyses and writing the article LS also collected data ISB, LS and HM participated in the planning of the study and discussions during data analyses, read the manuscript ... replaced according to the SF-36 manual [47] When an item was missing on the HADS and IES, missing data were replaced with the patients’ mean value for each subscale Data on categorical variables ... trauma patients who did not require intensive-care treatment • Identify predictors of health-related quality of life after trauma and hospital stay among demographic Page of 12 data, trauma characteristics,...
  • 12
  • 383
  • 0
  1. Luận Văn - Báo Cáo
  2. Báo cáo khoa học
Tài liệu developing a simple PL / SQL docx

Tài liệu developing a simple PL / SQL docx

Ngày tải lên : 10/12/2013, 17:15
... components and is reusable Two types of composite datatypes are available in PL/ SQL: TABLE and RECORD PL/ SQL Table D A PL/ SQL TABLE datatype is not the same as a database table D A PL/ SQL TABLE is ... Composite Datatypes continued Declaring PL/ SQL Tables Declare a TABLE datatype Declare a variable of that datatype Syntax TYPE type_name IS TABLE OF scalar_datatype [NOT NULL] INDEX BY BINARY_INTEGER; ... declared PL/ SQL variables Example Store the annual salary in a SQL* Plus global variable :g_annual_ salary := v_salary * 12; Developing a Simple PL/ SQL Block 21Ć41 21Ć42 Introduction to Oracle: SQL...
  • 56
  • 405
  • 1
  1. Công Nghệ Thông Tin
  2. Cơ sở dữ liệu
Tài liệu developing a simple PL / SQl pptx

Tài liệu developing a simple PL / SQl pptx

Ngày tải lên : 21/12/2013, 06:17
... Scalar Datatypes A scalar datatype holds a single value and has no internal components Scalar datatypes can be classified into four categories: number, character, date and time, or Boolean Character ... PL/ SQL TABLE datatype is not the same as a database table D A PL/ SQL TABLE is similar to a one-dimensional array D A PL/ SQL TABLE must contain two components: D D D A primary key of datatype BINARY_INTEGER ... declared PL/ SQL variables Example Store the annual salary in a SQL* Plus global variable :g_annual_ salary := v_salary * 12; Developing a Simple PL/ SQL Block 21Ć41 21Ć42 Introduction to Oracle: SQL...
  • 56
  • 379
  • 1
  1. Công Nghệ Thông Tin
  2. Cơ sở dữ liệu
Tài liệu Create a New Table with Data from Existing Tables doc

Tài liệu Create a New Table with Data from Existing Tables doc

Ngày tải lên : 21/01/2014, 12:20
... Use the SQL String to build the data adapter ' and fill the data table Dim odaResults As _ New OleDb.OleDbDataAdapter("Select * From MyProdAndCat", BuildCnnStr("(local)", "Northwind")) odaResults.Fill(dtResults) ... the SQL Statement in the lblSQLString Label to Display and Use Later Private Sub frmHowTo6_7_Load(ByVal sender As System.Object, _ ByVal e As System.EventArgs) Handles MyBase.Load ' Build the SQL ... odaResults.Fill(dtResults) Catch excp As Exception MessageBox.Show(excp.Message) Exit Sub End Try ' Assign the data table to the data grid's DataSource property Me.dgResults.DataSource = dtResults End...
  • 4
  • 376
  • 0
  1. Công Nghệ Thông Tin
  2. Cơ sở dữ liệu
Tài liệu Hyperlink from a Row in the Data Grid to a Detail Page ppt

Tài liệu Hyperlink from a Row in the Data Grid to a Detail Page ppt

Ngày tải lên : 21/01/2014, 12:20
... Private Sub Page_Load(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles MyBase.Load 'Put user code to initialize the page here Dim odaProdIndiv As OleDb.OleDbDataAdapter odaProdIndiv ... First Page of This How-To Object Property OleDbDataAdapter ID Setting odaProducts SelectCommand SELECT ProductID, ProductName FROM Products DataSet ID dsProducts DataGrid dgProducts DataSource ... DataKeyField ProductID DataMember Products ID hplReturnToMain NavigateURL HyperLink ID wfrmMain.aspx Right-click on the DataGrid control and choose Property Builder Click on the Columns tab and...
  • 5
  • 392
  • 0
  1. Công Nghệ Thông Tin
  2. Cơ sở dữ liệu
Tài liệu Retrieving Constraints from a SQL Server Database docx

Tài liệu Retrieving Constraints from a SQL Server Database docx

Ngày tải lên : 26/01/2014, 10:20
... CONSTRAINT_CATALOG nvarchar(128) Constraint name CONSTRAINT_SCHEMA nvarchar(128) Constraint owner CONSTRAINT_NAME sysname TABLE_CATALOG nvarchar(128) Database name TABLE_SCHEMA nvarchar(128) Table ... System.EventArgs e) { // Create the DataAdapter to retrieve schema information SqlDataAdapter da = null; if (primaryKeyRadioButton.Checked) da = new SqlDataAdapter(GETPRIMARYKEYCONSTRAINTS, ConfigurationSettings.AppSettings[ "Sql_ ConnectString"]); ... current database Table 6-10 REFERENTIAL_CONSTRAINTS information schema view Column name Data type Description CONSTRAINT_CATALOG nvarchar(128) Database name CONSTRAINT_SCHEMA nvarchar(128) Constraint...
  • 7
  • 393
  • 0
  1. Công Nghệ Thông Tin
  2. Kỹ thuật lập trình
Báo cáo khoa học: "A DOM Tree Alignment Model for Mining Parallel Data from the Web" doc

Báo cáo khoa học: "A DOM Tree Alignment Model for Mining Parallel Data from the Web" doc

Ngày tải lên : 08/03/2014, 02:21
... documents Parallel hyperlinks are used to pinpoint new parallel data, and make parallel data mining a recursive process Parallel text chunks are fed into sentence aligner to extract parallel sentences ... location holding more parallel data This approach is based on our observation that parallel pages share similar structures holding parallel content, and parallel hyperlinks refer to new parallel ... 130 Table Quality of Mined Parallel Sentences As we know, the absolute value of mining system recall is hard to estimate because it is impractical to evaluate all the parallel data held by a bilingual...
  • 8
  • 435
  • 0
  1. Luận Văn - Báo Cáo
  2. Báo cáo khoa học
Turbulent diffusion from a point source, laboratory data

Turbulent diffusion from a point source, laboratory data

Ngày tải lên : 18/05/2014, 19:36
... since any streamline found from potential flow caiculations can itself be considered a hill surface, the technique can be easily adapted to wide ranges of hill shapes For example, Bass et al have ... horizontal rake $ xW, y/k and z,/h are maximum concentration, lateral position, and location of maximum ~n~nt~t~on from vertical rake at that hrterai position R, in this case is zero The actual offset ... through larger distances normal to the plume axis before reaching the hill surface Also, the area of coverage of plume material on the hill surface is dramatically reduced as the stack height...
  • 34
  • 213
  • 0
  1. Khoa Học Tự Nhiên
  2. Vật lý
báo cáo hóa học: " Internal construct validity of the Warwick-Edinburgh Mental Well-being Scale (WEMWBS): a Rasch analysis using data from the Scottish Health Education Population Survey" potx

báo cáo hóa học: " Internal construct validity of the Warwick-Edinburgh Mental Well-being Scale (WEMWBS): a Rasch analysis using data from the Scottish Health Education Population Survey" potx

Ngày tải lên : 18/06/2014, 19:20
... has been argued that both the latter approaches are inappropriate, given that factor analysis is parametric and requires interval scaling, and Cronbach's Alpha does not address unidimensionality ... unidimensionality Educational and Psychological Measurements 1977, 37:827-838 McDonald RP, Ahlawat KS: Difficulty factors in binary data British Journal of Mathematical and Statistical Psychology ... random samples embedded within the data (Analyses & 7) Both subsets of data showed good fit to model expectations A linear transformation of the raw score, based upon the seven valid items, was...
  • 8
  • 462
  • 0
  1. Khoa Học Tự Nhiên
  2. Hóa học - Dầu khí
Chapter 27: An Introduction to PL/SQLThe Exception Handling section of a PL/SQL block is pot

Chapter 27: An Introduction to PL/SQLThe Exception Handling section of a PL/SQL block is pot

Ngày tải lên : 07/08/2014, 14:20
... the attributes of an abstract datatype, you must use a correlation variable for the table, as shown in this example To set the display attributes for an abstract datatype’s attributes in SQL* Plus, ... use a database event trigger to perform system maintenance functions immediately after each database startup For example, the following trigger pins packages on each database startup Pinning packages ... commands from within the package (such as calls from other procedures) Examples of packages are shown in “create package Syntax,” later in this chapter Packages may also include commands that are...
  • 108
  • 588
  • 0
  1. Công Nghệ Thông Tin
  2. Cơ sở dữ liệu

Xem thêm

Tìm thêm: