ph—a packetc replacement for c limits h functionality
Báo cáo toán học: "A Plethysm Formula for pµ (x) ◦ hλ (x) William F. Doran IV Department of Mathematics California Institute of Technology Pasadena, CA 91125" doc
Ngày tải lên :
07/08/2014, 06:20
... [D]) This concerns an algorithm for selecting the (xj , yj ) pairs which contribute to the statistic mi (T ) for a given T Here is the algorithm Select an ordering σ of the α many boxes which contain ... in each iteration might effect the outcome of the algorithm But, it has been shown (see Section 3.9 of [S] for a proof) that for all choices of the F’s, the resulting J(T ) is the same The next ... mi (T ) for all i If the swap of this kind F k j → j k F , where k > j, then since no element has changed which row it occupies, it is clear that all mi (T ) are unchanged However, if the swap...
- 10
- 397
- 0
Tài liệu I H C HU TRƯ NG I H C SƯ PH M CHƯƠNG TRÌNH GIÁO D C Đ I H C THEO H TH NG TÍN CH KH I docx
Ngày tải lên :
13/12/2013, 00:15
... Phương pháp nghiên c u khoa h c ĐVTC H c phần tiên quyết: không Nội dung môn h c bao gồm: kiến th c khoa h c nghiên c u khoa h c, chất nghiên c u khoa h c cấu tr c logic 10 c ng trình khoa h c; ... D C & ĐÀO TẠO ĐẠI H C HUẾ C NG H A XÃ H I CHỦ NGHĨA VIỆT NAM Đ c lập - Tự - H nh ph c CHƯƠNG TRÌNH GIÁO D C ĐẠI H C THEO H THỐNG TÍN CHỈ Tên chương trình: Chương trình giáo d c Đại h c Sư phạm ... tính loại tích phân để ứng dụng vi c giải toán vật lý Phần cuối h c phần trình bày chuỗi số, dãy h m chuỗi h m; h m biến ph c, tích phân h m biến ph c phép tính thặng dư 18 C h c ĐVTC H c phần...
- 26
- 338
- 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
Ngày tải lên :
18/02/2014, 17:20
... by the complicated relationship between ECs and non-ECs such as mural, hematopoietic and mesenchymal fibroblast cells, even though a conditional genetic modification such as endothelium-speci c knockouts ... using the same Tie2–Cre transgenic mouse line, which showed that recombination occurred in hematopoietic cells as well as ECs [27], and that cardiac valvular cells were derived from endothelial cells ... Magnetic-activated cell separation (MACS) columns and MACS goat anti-rat IgG microbeads (Miltenyi Biotec, Bergisch Galdbach, Germany) were used according to the manufacturer’s protocol Attached cells...
- 11
- 873
- 0
Tài liệu Báo cáo khoa học: Insulin-dependent phosphorylation of DPP IV in liver Evidence for a role of compartmentalized c-Src ppt
Ngày tải lên :
19/02/2014, 07:20
... glucose homeostasis [20] Knockout mice lacking the gene for DPP IV show enhanced insulin secretion and accelerated clearance of blood glucose coincident with increased endogenous levels of both ... antibody) The results revealed the coincident hyperphosphorylation of a 100-kDa band This is consistent with the view that a c- Src-dependent phosphorylation event had occurred (Fig 5A) Further fractionation ... (Imject Mariculture Keyhole Limpet Hemocyanin, Pierce Biotechnology Inc., Rockford, IL), following recommendations of the manufacturer This phosphosite is the major residue phosphorylated by Src...
- 12
- 738
- 0
Tài liệu Báo cáo khoa học: The most C-terminal tri-glycine segment within the polyglycine stretch of the pea Toc75 transit peptide plays a critical role for targeting the protein to the chloroplast outer envelope membrane ppt
Ngày tải lên :
19/02/2014, 07:20
... part of the glycine-rich stretch, but not the conserved hydrophobic domain or the second polyglycine stretch, was found to be necessary for correctly targeting the pea Toc75 protein to the outer ... tri-glycine segment within the polyglycine stretch is necessary for correct targeting of Toc75 Next, we wished to test whether the most C- terminal tri-glycine segment is sufficient for correct targeting ... Two scenarios have been postulated for the potential mechanism by which the polyglycine stretch mediates targeting of Toc75 to the chloroplast outer envelope [16] In the first scenario, this region...
- 9
- 496
- 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt
Ngày tải lên :
06/03/2014, 01:20
... of infection Chronic hepatitis B and chronic hepatitis C are serious and can result in liver cirrhosis and a type of liver cancer, hepatocellular carcinoma (HCC) The prevention of chronic hepatitis ... important risk factors for HCC are chronic HBV and HCV infections As stated above, an estimated 78% of HCC cases and 57% of liver cirrhosis cases are caused by chronic HBV and HCV infections (Perz ... with HBV and HCV, respectively Importantly, the prevention of chronic hepatitis B and chronic hepatitis C prevents the majority of HCC cases because HBV and HCV are the leading causes of this...
- 191
- 457
- 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc
Ngày tải lên :
06/03/2014, 01:20
... liver cancer, hepatocellular carcinoma (HCC) The prevention of chronic hepatitis B and chronic hepatitis C prevents the majority of HCC cases because HBV and HCV are the leading causes of this ... the prevention of chronic hepatitis B and chronic hepatitis C prevents the majority of HCC cases because HBV and HCV are the leading causes of this type of cancer Although the incidence of acute ... important risk factors for HCC are chronic HBV and HCV infections As stated above, an estimated 78% of HCC cases and 57% of liver cirrhosis cases are caused by chronic HBV and HCV infections (Perz...
- 253
- 369
- 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
Ngày tải lên :
07/03/2014, 05:20
... protein lacking the conserved sequence at the end of the C- terminal helix and Vps4p–E233Q (which has a mutation in the ATP hydrolysis site) Therefore, although the sequence at the end of the C- terminal ... Sequence (5¢- to 3¢) Vps4–DEL F Vps4–DEL R Vps4–TRP F Vps4–TRP R Vps4–RDF F Vps4–RDF R TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA ... RIX7) is included for interest The secondary structure of the C- terminal sequences of these proteins as predicted using Phyre is also shown [58] (H, helix; C, coil) S .c. , Saccharomyces cerevisiae...
- 23
- 490
- 0
Báo cáo khoa học: Molecular basis of perinatal hypophosphatasia with tissue-nonspecific alkaline phosphatase bearing a conservative replacement of valine by alanine at position 406 Structural importance of the crown domain potx
Ngày tải lên :
07/03/2014, 05:20
... 5¢-CCT GGC TAC AAG ATA GTG GGC GGT GAA-3¢ and 5¢-TTC ACC GCC CAC TAT CTT GTA GCC AGG-3¢; and V406F, 5¢-CCT GGC TAC AAG TTC GTG GGC GGT G-3¢ and 5¢-CAC CGC CCA CGA ACT TGT AGC CAG G-3¢, respectively ... (V406F) were created using the QuikChange II Site-Directed Mutagenesis kit with the following primers: V406L, 5¢-CCT GGC TAC AAG CTG GTG GGC GGT G-3¢ and 5¢-CAC CGC CCA CCA GCT TGT AGCCAG G-3¢; ... usually classified into the same amino acid group with a hydrophobic side chain Therefore, we hypothesized that not only hydrophobicity, but also the length of the alkyl side chain of the amino acid...
- 11
- 500
- 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc
Ngày tải lên :
07/03/2014, 12:20
... study cyt cox CH2OH OH O H O H HO cyt cred H CH2OH OH O O O H OH L-gulono-1,4-lactone OH L-ascorbic acid Fig Reaction catalyzed by the L-gulono-1,4-lactone dehydrogenase of M tuberculosis FEBS ... standard Ascorbic acid determination Mycobacterial cells were extracted with 5% m-phosphoric acid [51] or 5% perchloric acid [52], as described Ascorbic acid was measured by the HPLC method [51] ... l-gulono-1,4-lactone dehydrogenase with the Hsp60 heat-shock protein might reflect physiologic protein–protein interactions, as proposed for the plant Hsc70.3 cognate heat-shock protein and another vitamin C- related...
- 11
- 571
- 0
Chương 6 QU N TR CHI N LƯ CChi n lư c c p công tyTi n sĩ Nguy n Văn S.nM c tiêu nghiên c u1. Làm rõ t m quan tr ng c a chi n lư c c p công ty. 2. Tìm hi u n i dung cơ b n mà chi n lư c c p công ty ph i ñ t ra và gi i quy t. 3. N m ñư c các lo i hình potx
Ngày tải lên :
15/03/2014, 17:20
... c phát tri n theo chi u sâu ðư c doanh nghi p l a ch n khi: Ph i ng phó v i tình th khó khăn, suy thoái; Ho c, ch p th i c ñi u ki n thu n l i C c chi n lư c ñi u ch nh ho t ñ ng: Chi n lư c ... kh c Ph i h p ho t ñ ng gi a SBU ñó m t c ch hi u qu ñ giành l i th c nh tranh, th c ñ y s phát tri n c a doanh nghi p 6-6 M c tiêu c a chi n lư c c p c ng ty Tính ch t dài h n M c tiêu c th ... kinh doanh không hi u qu (ho c không th thích nghi v i bi n ñ ng c a môi trư ng) ñ c ng c cho s l i 6-27 Chi n lư c c ng c ho t ñ ng Gi i th , lý doanh nghi p: Khi không s c c nh tranh không th...
- 17
- 426
- 0
Chương 8 QU N TR CHI N LƯ CChi n lư c c p ch c năngTi n sĩ Nguy n Văn S.nM c tiêu nghiên c u1. Làm rõ t m quan tr ng c a chi n lư c c p ch c năng. 2. Tìm hi u n i dung cơ b n mà chi n lư c c p ch c năng ph i ñ t ra và gi i quy t. 3. N m ñư c các lo pptx
Ngày tải lên :
15/03/2014, 17:20
... n Chi n lư c c p ch c ? Vai trò c a chi n lư c c p ch c N-Series C c lo i chi n lư c c p ch c 8-3 Chi n lư c c p ch c ? ðó nh ng k ho ch t c nghi p t ng lĩnh v c ch c ñ c th h a chi n lư c c ... ñi m “coi tr ng phòng ng a kh c ph c ki m soát s n ph m h ng C n c b ph n ph n ng nhanh ñ gi i quy t u n i (v ch t lư ng s n ph m) c a khách h ng m t c ch nhanh chóng nh t ñi u ki n c th 8-15 ... m b o chi phí th p, hi u qu cao Chú tr ng b o m t thông tin cao ñ 8-30 15 K t lu n Chi n lư c ch c có m c tiêu ng n h n (ñôi c c m c tiêu trung h n) nh m c th h a ñưa chi n lư c c p c ng ty...
- 16
- 524
- 0
Báo cáo khoa học: A pathway through interferon-c is the main pathway for induction of nitric oxide upon stimulation with bacterial lipopolysaccharide in mouse peritoneal cells pot
Ngày tải lên :
17/03/2014, 10:20
... effect IFN -c and IL-12 + IL-18 on peritoneal cells of C3 H/ HeN and C3 H/ HeJ mice for production of NO Peritoneal exudate cells (PEC) of HeN mice (d) and HeJ mice (s), which have a defect in the ... with that in the adherent cell culture alone and reached the level observed in the whole cell culture of HeN-PEC (data not shown) This indicates that the production of IFN -c by nonadherent cells ... IFN -c and IL-12 + IL-18 PEC of C3 H/ HeN mice were cultured for h and the nonadherent cells washed off to obtain macrophages as adherent cells The whole-cell culture (grey column) without washing...
- 10
- 395
- 0
Radar-Based Intruder Detection for a Robotic Security System Phil Corya, H. R. Everettb, Tracy Heath pptx
Ngày tải lên :
22/03/2014, 11:20
... (CPLD) that controls the timing of the data acquisition system A block diagram of the processing electronics is shown in Figure The ADSP21060 SHARC processor was chosen because it was specifically ... measure the target characteristics of the potential threat so that it can be classified as either human or non-human The sensor configuration for the IDS is shown in Figure 2, with the radar ... in conjunction with the Doppler sampling frequency FS_DOP to select the appropriate velocity resolution for the velocity spectrum The FFT size also affects the processing gain that can be achieved...
- 11
- 321
- 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C pdf
Ngày tải lên :
22/03/2014, 17:20
... surveillance Immunization Through the years, the hepatitis B vaccine has been effective in the reduction of new HBV infections CDC’s Advisory Committee on Immunization Practices (ACIP), which provides ... approach is necessary to reduce the numbers of new HBV and HCV infections and the illnesses and deaths associated with chronic viral hepatitis Comprehensive viral hepatitis services should have ... evaluation The committee recommends that the Centers for Disease Control and Prevention (CDC) conduct a comprehensive evaluation of the national hepatitis B and hepatitis C public health surveillance...
- 4
- 404
- 1
Báo cáo khoa học: Structure of a trypanosomatid mitochondrial cytochrome c with heme attached via only one thioether bond and implications for the substrate recognition requirements of heme lyase potx
Ngày tải lên :
23/03/2014, 04:21
... Plasmids for T brucei cytochrome c (pKK223–Tbcytc), its CXXCH variant (pKK223–TbcytcCXXCH), S cerevisiae cytochrome c heme lyase (pACcyc3) and iso-1-cytochrome c (pScyc1) were as previously described ... level than the CXXCH wild-type [24,25] Thus, we coexpressed S cerevisiae cytochrome c heme lyase with either T brucei cytochrome c or a CXXCH variant in the cytoplasm of E coli (the cytochromes c ... whether euglenozoan cytochromes c with heme attached through a single cysteine would have the same attachment stereochemistry as cytochromes c with two thioether linkages [13] The fact that they...
- 11
- 513
- 0
Báo cáo khoa học: A structural basis for the pH-dependence of cofilin F-actin interactions potx
Ngày tải lên :
31/03/2014, 09:20
... location in the actin sequence for pH-dependent structural changes induced by cofilin in F-actin, a peptidic approach was then carried out Actin sequence correlated with pH effect Two interfaces ... 2002 pH-dependence of cofilin–actin interaction (Eur J Biochem 269) 4197 Fig Effect of pH on the fluorescence changes induced by the interaction of cofilin with actin or actin derivative synthetic peptides ... presence of actin suggesting that the actin–cofilin complex impedes the interaction of cofilin with the actin peptide The complex formation between the C- terminal sequence of actin with cofilin was then...
- 8
- 409
- 0
Báo cáo Y học: Arginine 121 is a crucial residue for the specific cytotoxic activity of the ribotoxin a-sarcin potx
Ngày tải lên :
31/03/2014, 23:20
... replace Arg121 with Lys (R121K) or Gln (R121Q) as described previously [20,30 –32] The mutagenic primers used were 50 -CCTGGCCCGGCGAAGGTCA TCTACACC-30 for R121K and 50 -CCTGGCCCGGCG CAGGTCATCTACACC-30 ... produced the a-fragment resulting from the speci c ribonucleolytic activity of these fungal Interaction with phospholipid vesicles The interaction of a-sarcin with model phospholipid vesicles through ... RNase T1, where the phosphate group can accept hydrogen bonds from Arg77(N 1H/ NhH) [22–24], although its role in catalysis has not been elucidated because no mutant forms at this position have been...
- 7
- 434
- 0