phương án tinh giản biên chế 6 tháng đầu năm 2008

Báo cáo y học: "Variants in the Toll-interacting protein gene are associated with susceptibility to sepsis in the Chinese Han population" ppsx

Báo cáo y học: "Variants in the Toll-interacting protein gene are associated with susceptibility to sepsis in the Chinese Han population" ppsx

Ngày tải lên : 14/08/2014, 07:21
... 26( 7.0%) 160 (43.1%) GG Genotypic comparison P rs3750920 rs5743 867 CC 64 ( 16. 6%) 32 (8 .6% ) CT 1 76 (45.7%) 161 (43.3%) TT 145 (37.7%) 179 (48.1%) GG AG 39 (10.2%) 1 96 (51.0%) 41 (11.1%) 210 ( 56. 6%) ... 0 .66 4 1. 06 (0.84-1.37) 1.04 (0.81-1.29) 0.752 0.794 0.591 0 .69 4 1. 06 (0. 86- 1.32) 1.02 (0.84-1. 26) 0.752 0.810 0.021 0.034 1.45 (1. 06- 1.98) 1.40 (1.03-1.88) 0.013 0.0 16 0 .60 7 0 .64 2 1. 06 (0.84-1.34) ... 0. 867 0.972 1.02 (0.82-1.27) 1.01 (0.72-1.38) 0. 867 0.911 0.000 16 0.00 062 0 .67 (0.54-0.82) 0.71 (0.59-0. 86) 0.001 0.0018 0.140 0.251 1.17 (0.95-1.44) 1.09 (0.82-1.39) 0.179 0.280 0 .63 5 0 .66 4...
  • 10
  • 391
  • 0
Spectral Theory and Nonlinear Analysis with Applications to Spatial Ecology pot

Spectral Theory and Nonlinear Analysis with Applications to Spatial Ecology pot

Ngày tải lên : 23/03/2014, 01:20
... lim 6- 0+ a; = at, in the sense of Definition 6. 1 of S Cano-Casanova and J L6pez-G6mez5 Thus, it follows from Theorem 4.2 of J L6pez-G6mez1O, and Theorem 7.1 of S Cano-Casanova and J L6pez-G6mez5, ... J L6pez-G6mez, Journal of Differential Equations 1 46, 3 363 74, (1998) S Cano-Casanova and J L6pez-G6mez, Journal of Differential Equations 178,123-211, (2002) S Cano-Casanova and J L6pez-G6mez, ... m e d spaces”, Notes Mat 39 (1 968 ) 1- 86 (Lectures Notes, Brasilia, 1 963 ) 25 L.-E Persson, Interpolation with a parameter function, Math Scand 59 (19 86) 199-222 26 A Pietsch, ‘%igenvalues and s-numbers”,...
  • 288
  • 435
  • 0
Algorithms and data structures with applications to graphics and geometry

Algorithms and data structures with applications to graphics and geometry

Ngày tải lên : 08/05/2014, 18:16
... 16. 3 Summation formulas 164 16. 4 Recurrence relations 166 16. 5 Asymptotic performance of divide-and-conquer algorithms 169 16. 6 Permutations 16. 7 Trees 161 161 163 170 171 17 SORTING AND ITS ... 1 56 148 Contents 15 .6 ix Complexity of matrix multiplication 157 16 THE MATHEMATICS OF ALGORITHM ANALYSIS 16. 1 Growth rates and orders of magnitude 16. 2 Asymptotics 16. 3 Summation formulas 164 ... expressions by counting 64 7.3 Analysis by recursive descent 7.4 Part III The role of syntax analysis 63 Turning syntax diagrams into a parser 66 66 Objects, algorithms, programs 69 TRUTH VALUES, THE...
  • 365
  • 446
  • 0
Báo cáo y học: "Association of FCGR2A and FCGR2A-FCGR3A haplotypes with susceptibility to giant cell arteritis" pdf

Báo cáo y học: "Association of FCGR2A and FCGR2A-FCGR3A haplotypes with susceptibility to giant cell arteritis" pdf

Ngày tải lên : 09/08/2014, 08:22
... Control GCA 0. 360 0.502 131R-158V 0.208 0.259 0.212 158F-NA2 0.347 0.444 158F-NA1 0.272 0. 268 158V-NA2 0.339 0.225 158V-NA1 0.042 0. 063 NA2-1206G 0.4 26 0.343 NA2-1206A 0.255 0.317 NA1-1206G 0.255 0.311 ... (0.44) 50 (0. 46) 35 (0.43) 11 10 (0.09) 10 (0.12) GG 59 (0.49) 36 (0.44) GA 47 (0.39) 34 (0.41) AA 15 (0.12) FCGR3B -0.07 -0 .64 -0.03 0.05 FCGR3B -0.31 FCGR2B 0. 06 (0. 06) 21 FCGR2B12 06 49 (0.43) ... (0.39) RH 63 (0.51) 33 (0.40) HH 32 (0. 26) 18 (0.22) FF 47 (0.41) 40 (0.48) Values of 0.3 and higher highlighted in bold FCGR2A FCGR2A131 FCGR3A158 FCGR3A FV 38 (0. 46) 19 (0. 16) 22 49 (0.45) 36 (0.44)...
  • 6
  • 410
  • 0
Báo cáo y học: "Association of mannose-binding lectin-2 genotype and serum levels with prognosis of sepsis" doc

Báo cáo y học: "Association of mannose-binding lectin-2 genotype and serum levels with prognosis of sepsis" doc

Ngày tải lên : 13/08/2014, 19:20
... 185 72.27 262 66 . 16 64 25.00 115 29.04 0.788 (0.550, 1.129) 0.194 0.815 (0.507, 1.312) 0.400 2.73 19 4.80 0.522 (0.215, 1. 266 ) 0.150 0.388 (0.127, 1.180) 0.095 GG 185 72.27 262 66 . 16 GA/AA 71 ... 31. 16 122 47.84 182 45.73 1.079 (0.749, 1.5 56) 0 .68 2 1. 060 (0.783, 3.598) 0.810 56 21. 96 92 23.12 0.980 (0 .63 3, 1.518) 0.929 1.333 (0.755, 2.355) 0.322 GG 77 30.20 124 31. 16 GC/CC 178 69 .80 274 68 .84 ... 3945) 0.000 GC 955 (335 262 6) 810 (60 0 1 360 ) 1530bc ( 860 2400) L CC 384 (0 1284) 340 (275 710) 64 0c (300 163 0) A GG 2249 (1333 3352) GA 315 (3 540) 460 b (335 69 5) 475b (298 69 5) B AA 270 (135-280)...
  • 9
  • 281
  • 0
1 adaptive mode superposition and acceleration technique with application to frequency response function and its sensitivity

1 adaptive mode superposition and acceleration technique with application to frequency response function and its sensitivity

Ngày tải lên : 03/12/2014, 23:41
... 79 (1) (2001) 87– 96 [5] C Huang, Z.-S Liu, S.-H Chen, An accurate modal method for computing response to periodic excitation, Computers and Structures 63 (3) (1997) 62 5 63 1 [6] J.M Dickens, J.M ... Exact 0.001 0.0001 0.00001 10 -6 10-7 FRF FRF 10 -6 10-7 10-8 10-8 10-9 10-10 10-9 10-10 51 10-11 200 (a) 400 60 0 Frequency (rad/s) 800 1000 10-12 1300 (b) 1320 1340 1 360 1380 1400 Frequency (rad/s) ... (b) middle frequency range 100 140 120 80 80 Mode Mode 100 60 40 60 40 20 20 0 200 400 (a) 60 0 800 1000 200 (b) Frequency (rad/s) 400 60 0 800 1000 1380 1400 Frequency (rad/s) Fig Number of modes...
  • 18
  • 320
  • 0
Get phrasal verbs in term of syntactic and semantic features with reference to vietnamese equivalents

Get phrasal verbs in term of syntactic and semantic features with reference to vietnamese equivalents

Ngày tải lên : 17/07/2015, 11:16
... 4.2 From learners’ perspective 61 Part III: CONCLUSION 64 Recapitulation 64 Limitations of the study 65 Suggestions for a further study 66 APPENDICE 67 REFERENCES 76 ix INTRODUCTION Rationale of ... on the semantic features Item No Correct Percentage Incorrect Percentage 24 24% 76 76% 38 38% 62 62 % 36 36% 64 64 % As shown in Table 2.3, among the six tasks of the test, task is considered the ... features of ‘get’ phrasal verbs can be summarized in Figure 2.1 90 80 70 60 50 40 30 20 10 80 82 76 78 Task 62 64 Task Task 38 36 18 22 20 24 Task Task Task Non-passed (22 Ss) Passed (78 Ss) Figure...
  • 92
  • 1K
  • 9
Báo cáo y học: "Genetic polymorphism of p53, but not GSTP1, is association with susceptibility to esophageal cancer risk – A Meta-Analysis"

Báo cáo y học: "Genetic polymorphism of p53, but not GSTP1, is association with susceptibility to esophageal cancer risk – A Meta-Analysis"

Ngày tải lên : 25/10/2012, 11:40
... [22,24,25] 1052 2 063 1.35 1.14-1 .60 0.09 Mix [19,23,27] 1 868 2011 1.04 0. 86- 1.25 0 .60 Asian [22,25,29,31,32] 64 1 1415 0.99 0 .66 -1.49 0.00 Caucasian [19,20,30,33] 1 768 1970 1. 06 0. 86- 1.31 0.02 p53 ... 12.3 28.9 66 / 164 0.412 0. 16 0. 26/ 0.19 19.2 49.2 34/247 0.739 0.23 3 .65 /3.44 16. 4 40.7 150/150 0 .61 6 0.22 1.47/0.89 33.5 77.1 90/254 NA# NA#/ NA# NA# NA# 45/45 0.019 0.29 0.78/2.51 14 .6 35.1 131/454 ... 2009 United States Caucasian p53 Arg77Pro 302/453 0. 066 0. 26 1.05/01.18 70 .6 99.2 Caucasian p53 Arg78Pro 1492/1443 0 .66 0 0.73 1.00/0.95 99 .6 100.0 Canova C[19] 2009 European * The ref was referred...
  • 9
  • 615
  • 0
Báo cáo khoa hoc:" Variation in the CXCR1 gene (IL8RA) is not associated with susceptibility to chronic periodontitis" ppt

Báo cáo khoa hoc:" Variation in the CXCR1 gene (IL8RA) is not associated with susceptibility to chronic periodontitis" ppt

Ngày tải lên : 11/08/2014, 07:21
... 55(48.25) 7.73e-05 3.47 (1.82 -6. 63) 48(37.21) 13(30. 96) 81 (62 .79) 29 (69 .04) 5.89e-10 1.14e-07 6. 42 (3.4-12.1) 8. 46 (3 .64 -19 .63 ) 60 -69 2(14.29) 12(85.71) 4.94e-07 23.3 (5.19-104 .65 ) > 70 Gender Periodontitis ... 16 ( 26. 67) 1 56 ( 46. 58) 44 (73.33) 2.203134e-05 Reference 3.8 (1.97-7.33) GG 164 (84.1) 166 (83.3) CG 28 (14.4) 31(15.5) 0.55 1.2 (0 .65 -2.2) CC (1.5) (1.5) 0.89 1.13 (0.18-7.27) G 3 56 (91.3) 363 ... Control n = 195 (%) 1(20) 4(80) 3 .67 e-03 13.77 (1 .67 -113.32) Reference Smoking habits Polymorphism rs223 467 1 Male 81(50.94) 78 (49. 06) Female 114 (48.31) 122 (51 .69 ) 0 .65 1.11 (0.7-1.74) Reference...
  • 5
  • 328
  • 0
Báo cáo y học: "TLR2 and TLR4 triggering exerts contrasting effects with regard to HIV-1 infection of human dendritic cells and subsequent virus transfer to CD4+ T cells" docx

Báo cáo y học: "TLR2 and TLR4 triggering exerts contrasting effects with regard to HIV-1 infection of human dendritic cells and subsequent virus transfer to CD4+ T cells" docx

Ngày tải lên : 12/08/2014, 23:20
... Virol 2007, 81:8933-8943 Page 15 of 16 (page number not for citation purposes) Retrovirology 2009, 6: 42 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 Izquierdo-Useros N, Blanco J, Erkizia ... receptor 2: role of N-terminal hydrophobic portion in its multiple functions J Immunol 2001, 166 : 261 0- 261 6 Makimura Y, Asai Y, Taiji Y, Sugiyama A, Tamai R, Ogawa T: Correlation between chemical ... PCR Master Mix (Applied Biosystems, Foster City, CA), μM of the sense primer M 667 , μM of the antisense primer M 661 (late RT) or AA55 (total RT), and 0.3 μM of the TaqMan probe HIV-5'carboxyfluorescein...
  • 16
  • 288
  • 0
báo cáo khoa học: "Serum proteomic profiling and haptoglobin polymorphisms in patients with GVHD after allogeneic hematopoietic cell transplantation" pps

báo cáo khoa học: "Serum proteomic profiling and haptoglobin polymorphisms in patients with GVHD after allogeneic hematopoietic cell transplantation" pps

Ngày tải lên : 10/08/2014, 22:20
... 552 66 1 66 3 66 4 488 489 491 489 513 528 488 491 488 491 492 537 547 5 56 7 26 7 26 4 16 5 56 5 26 46 46 45 45 40 21 21 21 47 46 48 46 46 45 47 48 47 48 48 39 38 36 13 13 29 36 31 4.8 5.1 5.2 5.4 5 .6 ... cGVHD mechanism pH7 pH4 pH7 250 150 100 75 4 16 492 489 50 - 491 25 - 513 522 532 528 552 550 37 - 5 26 537 488 585 5 56 547 66 1 66 3 20 - 7 26 664 15 - a 7 26 b Figure A paired 2-DE gel images from a ... 53.4 47.1 22.4 6. 5 newly appeared 22.8 12.3 7.4 60 .2 53.4 21.0 53.4 47.1 16. 5 60 .2 21.0 50.2 21.0 1.2 0 .6 0.5 absence 0.1 0.1 absence 0.2 absence +4.2 +7.3 +6. 5 +8.4 P 067 27 P01009 P27 169 P25311 P04278...
  • 12
  • 446
  • 0
Association studies of genetic polymorphisms found in interleukins 12, 13 and CD14 gene with asthma and allergic diseases

Association studies of genetic polymorphisms found in interleukins 12, 13 and CD14 gene with asthma and allergic diseases

Ngày tải lên : 30/09/2015, 14:23
... Polymorphism Primers Temp o -1512 5’ – CAACCGCCGCGCCAGCGCCTTCTC – 3’ C Size (bp) 68 2 46 68 2 46 65 559 68 2 36 63 473 5’ – CCGCTACTTGGCCGTGTGACCGC – 3’ -1112 5’ – GGAATCCAGCATGCCTTGTGAGG – 3’ 5’ ... important for the 16 binding of Janus tyrosine kinases (JAK) [66 ] The receptors exhibit constitutively associated JAKs, and results in recruitment of downstream signaling molecules [66 ] The IL-13 receptor ... (3):5 06 – 513 [1] J Allergy Clin Immunol IL-13 Intron +1923 465 78 CÆT 2000 Mar; 105 (3):5 06 – 513 [1] Arg130Gln, IL-13 Exon +2044 R130Q, J Allergy Clin Immunol GÆA 2000 Mar; 105 (3):5 06 – 513...
  • 118
  • 709
  • 0
Báo cáo y học: "Effects of p-Synephrine alone and in Combination with Selected Bioflavonoids on Resting Metabolism, Blood Pressure, Heart Rate and Self-Reported Mood Changes"

Báo cáo y học: "Effects of p-Synephrine alone and in Combination with Selected Bioflavonoids on Resting Metabolism, Blood Pressure, Heart Rate and Self-Reported Mood Changes"

Ngày tải lên : 25/10/2012, 11:04
... 72.7(9.8) 71.8(10.0) 76. 9 (6. 4) 75.3(7.8) 0.3 16 0.891 Baseline 64 .5(11.2) 72.3(5.1) 70.0(14.0) 71 .6( 13.3) 69 .4 (6. 4) 0.518 Ending 62 .7(9.4) 71 .6( 6.7) 65 .7(9.0) 68 .6( 9.5) 68 .0(8.4) 0.2 06 1ANOVA Placebo: ... 117.9(14.4) 125 .6( 12 .6) 0.794 Ending DIASTOLIC 123.3(18.3) 120.3(9.0) 120.9(11.4) 119.3(15.5) 130.8(10.2) 0.317 Baseline Ending HEART RATE 71.3 (6. 9) 75.0(9.1) 73.8 (6. 4) 74 .6( 8.3) 77.0 (6. 3) 75.5(10.0) ... Advantra Z® with mg hesperidin and 60 0 mg naringin Group 4: Advantra Z® with 100 mg hesperidin and 60 0 mg naringin Group 5: Advantra Z® with 1,000 mg hesperidin and 60 0 mg naringin After remaining...
  • 7
  • 641
  • 0
Báo cáo y học: "Weight loss, leukopenia and thrombocytopenia associated with sustained virologic response to Hepatitis C treatmen"

Báo cáo y học: "Weight loss, leukopenia and thrombocytopenia associated with sustained virologic response to Hepatitis C treatmen"

Ngày tải lên : 26/10/2012, 09:39
... 11, n (%) 16 (64 )a 10 (77)b 0.07 HCV RNA (x1 06 IU/mL, mean ± SD) 4 .6 5 .6 8.3±15 .6 0.22 Weight (kilograms, mean ± SD) 92.1±22.2 77.9± 16. 0 0.10 WBC (X 103 cells/µl, mean ±SD) 6. 6±3.1 6. 8±2.8 0.97 ... 1.8 11.7±1.5 0.42 Platelet (X 1 06 cells/µl, mean ± SD) 122.4 ± 96. 8 207.2± 86. 5 0.05* End of treatment laboratory data ALT (U/L, mean ± SD) 35.3 ± 26. 8 36. 6±28.1 0 .60 Total bilirubin (g/dl, ) mean ... gender, n (%) 36 (67 ) Ethnicity, n (%) Caucasian 31 (57) Asian 10 (19) Hispanic (13) Hawaiian (11) Others (6) Age, years, mean ± SD 52.5±5.8 HCV genotypes, n (%) Genotype 30 ( 56) Genotype ( 16) Genotype...
  • 7
  • 519
  • 0
Báo cáo y học: No associations of Helicobacter pylori infection and gastric atrophy with plasma total homocysteine in Japanes

Báo cáo y học: No associations of Helicobacter pylori infection and gastric atrophy with plasma total homocysteine in Japanes

Ngày tải lên : 31/10/2012, 14:34
... 2003; 88: 159 -66 Leung WK, Ma PK, Choi PC, et al Correlation between Helicobacter pylori infection, gastric inflammation and serum homocysteine concentration Helicobacter 2001; 6: 1 46- 50 Sipponen ... pylori, and coronary heart disease Heart 19 96; 76: 305-7 40 Kang SS, Wong PW, Norusis M Homocysteinemia due to folate deficiency Metabolism 1987; 36: 458 -62 41 Stabler SP, Marcell PD, Podell ER, ... the pepsinogen test The H pylori positive perticipants were 115 (66 .1%) in all patients, and gastric atrophy was observed in 46/ 170 (27.1%) The gastric atrophy was in 39.1% among 115 positive...
  • 7
  • 578
  • 1
TChon 17 PRESENT SIMPLE AND PRESENT PROGRESSIVE WITH FUTURE MEANING.doc

TChon 17 PRESENT SIMPLE AND PRESENT PROGRESSIVE WITH FUTURE MEANING.doc

Ngày tải lên : 08/07/2013, 01:27
... b I don’t think so 23 Is 6. 30 all right? c Yes, I am 34 I’m not a teacher d Go to the library 45 It’s raining e That’s fine 56 You look very happy today f I’d love to 67 Do I know her? g Yes,...
  • 2
  • 1.2K
  • 30
GROWTH PERFORMANCE AND SPERM QUALITY OF STRESS NEGATIVE PIÉTRAIN BOARS AND THEIR HYBRIDS WITH DUROC

GROWTH PERFORMANCE AND SPERM QUALITY OF STRESS NEGATIVE PIÉTRAIN BOARS AND THEIR HYBRIDS WITH DUROC

Ngày tải lên : 28/08/2013, 11:59
... 0.57 b 392.79 ± 18 .65  b 66 .87 ± 4.07 4 .62 ± 0.40 b 7.49 ± 0.03 a 76. 68 ± 0.72 b 517.01 ± 23 .68  b 88.49 ± 5.20 77.82 ± 0.42 394.92 ± 13 .66  70. 06 ± 2.98 4.72 ± 0. 26 a 7 .61 ± 0.02 b a a ... ± 18.30 b 8. 96 ± 0 .68 107.17 ± 4.73 bc 552.93 ± 22.88 b 8.72 ± 0. 86 b 57 .64 ± 1 .68 bc 63 .87 ± 0.90 57.44 ± 1.33 63 .57 ± 0.71 b c 5 16. 00 ± 20.88 b 8.42 ± 0.78 b 61 .65 ± 1.54 b bc 65 .11 ± 0.82 ... ab 101.22 ± 4.31 118.27 ± 3.73 ab 62 4.09 ± 18. 06 a BF (mm) 11. 96 ± 0 .68 119 .67 ± 2.87 a 63 5.07  ± 13.88 ab 10.79 ± 0.51 a 57.08 ± 1.01 a 61 .55 LD (mm) 51. 46 ± 1.33 LM (%) 59.02 ± 0.71 b ab ±...
  • 6
  • 734
  • 0
River Water Quality Analysis of Hadano Basin and its Relationship with Nonpoint Sources of Pollution

River Water Quality Analysis of Hadano Basin and its Relationship with Nonpoint Sources of Pollution

Ngày tải lên : 05/09/2013, 10:17
... atmospheric N Fig 26 - Correlation of TDS with unsewered population Table Correlation Coefficients in Simple Regression Water Quality Parameter COD TP TN TDS Unsewered Population 0 .62 6 0 .63 8 0. 363 0.752 ... TP TN TDS 0 .65 7 0 .66 1 0 .61 3 0.775 Standard Partial Regression Coefficients Unsewered Population 0.571 0 .61 2 0.355 0.729 Agriculture Area 0.272 0.229 0.131 0.204 Atmospheric N 0 .63 0 - considered ... While at Ishiuchiba sub-basin, pollution loads Unsewered Population (Person) - 269 270 - 547 548 - 10 36 1037 - 1 964 1 965 - 3417 Drainage Basin Hadano Basin Fig - Unsewered population of each drainage...
  • 28
  • 593
  • 0
CHART OF MODAL AND SIMILAR EXPRESSION(WITH EXCISES)

CHART OF MODAL AND SIMILAR EXPRESSION(WITH EXCISES)

Ngày tải lên : 14/09/2013, 01:10
... 15 you ………… add it up I’m not good at figures.(a.have to/b ought to/c ‘d better/ both b and c) 16 the phone has been ring ing for a minute Noone …………at home(must have been/ can have been/ should ... (couldn’t/can’t/won’t/wouldn’t) 25 …………make an appointment to see the doctor? (May I / Could I / Will I/ Shall I ) 26 Perhaps there ……… A good pro gram on the radio (might be/ will be/ can be/ should be) 27 I ……go ... I’m not sure where to go for my holiday, but I …… go to China (should/ may/ have to/ needn’t) 36 we had free tickets, so we ……….pay to get into the concert (didn’t have to/ couldn’t/mustn’t/...
  • 3
  • 584
  • 4

Xem thêm