phosphorescence spectroscopy as a probe of the glassy state in amorphous solids
Tài liệu Báo cáo Y học: Use of site-specific recombination as a probe of nucleoprotein complex formation in chromatin Micha Schwikardi and Peter Droge ¨ potx
Ngày tải lên :
22/02/2014, 07:20
... for a phage l integrase mutant was set as 100% In each case, data were collected from six separate transfection assays, each employing two wells containing about  105 cells (C) Normalized b-Gal ... electroporation b-Galactosidase (b-gal) assays, Southern blotting and PCR b-Gal assays and Southern blotting were performed as described previously [10,17] The 32 P-labelled probe was generated by ... recombination on episomal and on genomic targets, we have shown that the dynamic nature of chromatin renders a site of at least 34 bp in general reactive for recombination However, the assembly of...
- 7
- 472
- 0
top-antitop cross section measurement as a function of the jet multiplicity in the final state and beyond the standard model top-antitop resonances search at the atlas detector at cern
Ngày tải lên :
22/12/2014, 22:04
... includes the coupling of the matter fields with the W and B fields in the kinetic term of the Lagrangian The gauge fields have their kinetic terms added in the gauge part of the Lagrangian as a − Wµν ... dynamically generates their mass The interaction terms between the Higgs boson and the matter fields are added in the Yukawa sector of the Lagrangian Note as well that the gauge bosons have their ... predicts a resonance decaying in a top-antitop pair, using ATLAS data at center -of- mass √ energy of s = TeV The latter analysis is repeated for ATLAS data col√ lected with s = TeV Performance studies...
- 251
- 712
- 0
Reading Theory as a Microcosm of the Four Skills
Ngày tải lên :
06/09/2013, 10:10
... teachers as they are the backbone of many schools in Ireland and Britain One of the most important initial tasks for any teacher is the task of knowing his clients The notion of needs analysis is absolutely ... central Even with as few details as we have outlined above, there are certain things that we can assume about this group First, given their age group, it is reasonable to assume that many of them ... constraints, at many different levels, on each occasion that they are called upon, they encourage a unique emphasis on particular combinations of strategies on each occasion In reading, the notions...
- 5
- 680
- 0
Tài liệu Báo cáo khoa học: Deciphering enzymes Genetic selection as a probe of structure and mechanism docx
Ngày tải lên :
19/02/2014, 12:20
... pKIMP-UAUC Random gene libraries are introduced into this strain and the ability of a cell harboring an individual library member to form a colony on minimal agar media lacking added phenylalanine and ... chorismate mutase–prephenate dehydratase and chorismate mutase–prephenate dehydratase were deleted Monofunctional versions of the dehydratase and the dehydrogenase are provided by plasmid pKIMP-UAUC ... constraints, such as packing interactions and polar/nonpolar patterning, on functional sequences Genetic selection of CM libraries has been an invaluable tool in the engineering of drastically...
- 8
- 635
- 0
Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt
Ngày tải lên :
08/03/2014, 10:20
... Mansouri and Winterhalter [5] reported that the oxidation of the a chains of Hb A0 was 10 times faster than that of the beta chains and that the oxidation of the beta chains was not in uenced by pH The ... presence of EDTA The rough S minnesota LPS increased the initial fast phase of the reaction, but decreased the rate of the slow phase of oxidation in the presence of EDTA A comparison of rough and ... during the auto-oxidation of Hb In general, the increase in the oxidation rate of crosslinked Hb mediated by LPSs is due to an increase in the rate of the initial fast phase, i.e oxidation of the a...
- 6
- 748
- 0
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot
Ngày tải lên :
23/03/2014, 05:22
... GTTGGTCTCGTCGCTCATCACATCACGAGG GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG ... GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 82898–82923 83581–83552 91489–91517 ... specific to each MAP As a control, mouse brain samples were also analyzed in parallel The amount of the brain soluble fraction and dCAD cell extract used in these experiments as input material was 30-fold...
- 14
- 416
- 0
báo cáo hóa học: " Physical activity as a mediator of the impact of chronic conditions on quality of life in older adults" pptx
Ngày tải lên :
18/06/2014, 22:20
... activity in promoting quality of life in older adults The data were collected by Statistics Canada under the authority of the Statistics Act Access to the data was granted by Statistics Canada based ... activity was specified as a mediator of this relationship The Pratt-Index (d) [25] was used to partition the R-square so as to determine the relative importance of the variables explaining the HUI3 ... funding, assisted with the interpretation of the results and contributed to the writing and editing of multiple drafts CAM was involved in the design, assisted in the interpretation of results and...
- 11
- 619
- 0
Báo cáo sinh học: " The Severe Acute Respiratory Syndrome (SARS)-coronavirus 3a protein may function as a modulator of the trafficking properties of the spike protein" docx
Ngày tải lên :
18/06/2014, 22:20
... viral RNA It may also enhance virus packaging as it appears that the assembly of coronavirus occurs intracellularly, probably in the intermediate compartments between the endoplasmic reticulum and ... concentrated the protein in clathrin-coated vesicle, which then budded from the plasma membrane resulting in internalization However, it appears that the YxxΦ motif can also bind other adaptor protein ... [9,10] 3a (also termed ORF3 in [2] and [11], as X1 in [3], and as U274 in [12,13]) is the largest "accessory" protein of SARS-CoV, consisting of 274 amino acids and putative transmembrane domains...
- 5
- 310
- 0
báo cáo hóa học:" The Severe Acute Respiratory Syndrome (SARS)-coronavirus 3a protein may function as a modulator of the trafficking properties of the spike protein" docx
Ngày tải lên :
20/06/2014, 04:20
... viral RNA It may also enhance virus packaging as it appears that the assembly of coronavirus occurs intracellularly, probably in the intermediate compartments between the endoplasmic reticulum and ... concentrated the protein in clathrin-coated vesicle, which then budded from the plasma membrane resulting in internalization However, it appears that the YxxΦ motif can also bind other adaptor protein ... [9,10] 3a (also termed ORF3 in [2] and [11], as X1 in [3], and as U274 in [12,13]) is the largest "accessory" protein of SARS-CoV, consisting of 274 amino acids and putative transmembrane domains...
- 5
- 365
- 0
Báo cáo y học: "Cornual pregnancy as a complicaton of the use of a levonorgestrel intrauterine device: a case report" pdf
Ngày tải lên :
11/08/2014, 14:20
... have a case to share? Submit your case report today • Rapid peer review • Fast publication • PubMed indexing • Inclusion in Cases Database Any patient, any case, can teach us something www.casesnetwork.com ... mmHg and she was afebrile There was slight tenderness in her right lower abdominal quadrant No guarding or rebound tenderness was noted, and no abdominal mass was palpable Laboratory findings ... twodimensional transvaginal sonogram revealed a sac situated external to the endometrial cavity in the right cornua of the uterus (>1 cm from the most lateral edge of the uterine cavity) containing an embryo...
- 4
- 341
- 0
Báo cáo khoa học: " Air embolism as a cause of the systemic inflammatory response syndrome: a case report" pps
Ngày tải lên :
12/08/2014, 19:22
... pulmonary artery catheter, approximately 20 hours after the removal of the introducer, the patient’s cardiac index was elevated and the systemic vascular resistance was low These parameters normalized ... systemic vascular resistance, tachypnea, fever and diffuse intravascular coagulation) was compatible with the diagnosis of SIRS The rapidity of the patient’s recovery, as well as the lack of positive ... such as heparin [10] and lidocaine [15] attenuate the thrombo-inflammatory response of the endothelium to luminal air In conclusion, the removal of an internal jugular vein sheath introducer in...
- 3
- 219
- 0
Báo cáo y học: "Socioeconomic status (SES) as a determinant of adherence to treatment in HIV infected patients: a systematic review of the literature" docx
Ngày tải lên :
13/08/2014, 06:20
... education in the presentation of the data Findings In Table we present the main findings regarding the analysis of the association of the various components of SES and adherence Income, level of ... the measure of adherence, the overall adherence and findings regarding the association between major determinants of SES and adherence In this study we assessed three parameters as major factors ... HIV infected patients Since there was no study directly examining the association between SES and adherence in patients with HIV/AIDS, we evaluated the available data regarding the possible association...
- 12
- 319
- 0
the subsidy regulations and vietnam’s position as a member of the wto
Ngày tải lên :
18/08/2014, 12:35
... used in cases For example, in the case “Canada – Measures Affecting the Export of Civilian Aircraft”, the Appellate body of the WTO affirmed that the term “benefit” was determined by a comparison ... experience of anti-subsidy cases is a reasonable way for Vietnam to learn about them Before taking part in anti-subsidy cases as an independent plaintiff Vietnam should join other countries as a concerned ... widen the meaning of the term to allow payments to be classed as financial contributions even though they are not within the strict meaning of the term.21 In a debate of Canada over two dispute cases,...
- 59
- 314
- 0
Stock price reaction to the announcement of a reverse stock split, an investigation as a function of the rationale provided
Ngày tải lên :
30/09/2015, 16:58
... splits Table A1 a in the Appendix provides a summary of these studies and the findings pertaining to abnormal returns Many of these studies investigated other aspects of reverse splits such as liquidity ... Table A1 5: ARE and CAR Means and Standard Deviations by Stock Exchange Listing 188 Table A1 6: Listing of Companies in Final Sample in Reverse Split Size Category 189 Table A1 7: ARE and CAR Means and ... Standard Deviations by Size of Reverse Split Ratio 190 Table A1 8: Listing of Companies in Final Sample by Average Two-Year Growth Rate in Revenues 191 Table A1 9: ARE and CAR Means and Standard...
- 217
- 227
- 0
Tiểu luận tiếng anh : Robinson Crusoe – A Representative of the English Bourgeoisie in the early 18th century
Ngày tải lên :
26/11/2012, 12:02
... turned into pastures for sheep-raising and wood-making industries They had to join the force of cheap labor and working in such factories England became a typical example of initial accumulation of ... coloniser as well as a forein trader When he is left alone on the uninhabited island, he is realistically depicted as a man struggling against nature and a man who finally creates some civilisation in ... Master servant relationship in “ Robinson Crusoe” can also be seen as a relation of capitalism as they devided labour among them with equal shares The fact is that Robinson saved Friday from the...
- 15
- 2.3K
- 9
MAKING A CHART OF THE ENERGY CONSUMPTION IN H.C.M. CITY
Ngày tải lên :
22/07/2013, 01:27
... omission ASSESSMENT Assessment and correction Marks Having enough partners’ ideas Right as the ideas are led Completing the group’s duty Having the creative combination’s ideas +1 Having plenty of ... has to take part in their work going to each of the family in their neighbour to take the notes of the amount of energy they spent (water, electricity, ,oil,coal…) in a module of time or looking ... ACTION PLAN MAKING A CHART OF THE ENERGY CONSUMPTION IN H.C.M CITY INTRODUCTION OF GOAL • In new basic program of English 11.Unit 11 “sources of energy” Part D writing: describing information...
- 8
- 406
- 0
A study of the dominant topics in some typical works of augustan period (1700 1745) = nghiên cứu về những chủ đề nổi bật trong một số tác phẩm điển hình thời kì augustan (1700 1745)
Ngày tải lên :
14/12/2013, 00:41
... win fate and proved that human kind with he will and mind was ability to anything The image of Robinson standing valiantly on the island was a beautiful image that asserted that human being was ... lands and discriminated from the uncanny race of local inhabitants about appearance, Swift wanted to indirectly blame an aspect of the discrimination That was the discriminating attitude of the ... growing of colloquialism in practice as well as in literature What is more, the appearing of a great deal of books of travel and traveling was one of the favorite topics of readers The political...
- 47
- 695
- 0
A History of the English Church in New Zealand pot
Ngày tải lên :
06/03/2014, 12:21
... natives have been casting balls all day in Mr Kemp's shop They come in when they please, and what they please, and take away what they please, and it is vain to resist them." Marsden and the Home authorities ... help feeling that at least here was a man who had had experience of real, not of imaginary, heathen; a man who did not despair, and who had a definite and carefully prepared plan Gradually they yielded ... the remembrance of past injuries melted away before the sunshine of Christian love; and, before the ship reached Australia, Ruatara was once again a man, and now almost a Christian This meeting...
- 243
- 550
- 0